ID: 1044911917

View in Genome Browser
Species Human (GRCh38)
Location 8:97068786-97068808
Sequence ATGAAGAAACAGACTCATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044911912_1044911917 22 Left 1044911912 8:97068741-97068763 CCATCCTATGAAGGAGGTACAAT 0: 1
1: 1
2: 3
3: 32
4: 189
Right 1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG No data
1044911910_1044911917 30 Left 1044911910 8:97068733-97068755 CCATACAACCATCCTATGAAGGA 0: 2
1: 1
2: 11
3: 91
4: 490
Right 1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG No data
1044911914_1044911917 -10 Left 1044911914 8:97068773-97068795 CCCTATTTTGCAGATGAAGAAAC 0: 5
1: 102
2: 848
3: 3291
4: 8279
Right 1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG No data
1044911913_1044911917 18 Left 1044911913 8:97068745-97068767 CCTATGAAGGAGGTACAATTATC 0: 1
1: 1
2: 29
3: 172
4: 824
Right 1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044911917 Original CRISPR ATGAAGAAACAGACTCATAA GGG Intronic
No off target data available for this crispr