ID: 1044923702

View in Genome Browser
Species Human (GRCh38)
Location 8:97191196-97191218
Sequence TAAATGACTTTGAGGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044923692_1044923702 20 Left 1044923692 8:97191153-97191175 CCTACCTCTCCAGGTCTTCCTTT No data
Right 1044923702 8:97191196-97191218 TAAATGACTTTGAGGTTGGTGGG No data
1044923696_1044923702 -6 Left 1044923696 8:97191179-97191201 CCTATCCCATAAGTTTCTAAATG No data
Right 1044923702 8:97191196-97191218 TAAATGACTTTGAGGTTGGTGGG No data
1044923691_1044923702 21 Left 1044923691 8:97191152-97191174 CCCTACCTCTCCAGGTCTTCCTT No data
Right 1044923702 8:97191196-97191218 TAAATGACTTTGAGGTTGGTGGG No data
1044923694_1044923702 11 Left 1044923694 8:97191162-97191184 CCAGGTCTTCCTTTTTGCCTATC No data
Right 1044923702 8:97191196-97191218 TAAATGACTTTGAGGTTGGTGGG No data
1044923695_1044923702 2 Left 1044923695 8:97191171-97191193 CCTTTTTGCCTATCCCATAAGTT No data
Right 1044923702 8:97191196-97191218 TAAATGACTTTGAGGTTGGTGGG No data
1044923693_1044923702 16 Left 1044923693 8:97191157-97191179 CCTCTCCAGGTCTTCCTTTTTGC No data
Right 1044923702 8:97191196-97191218 TAAATGACTTTGAGGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044923702 Original CRISPR TAAATGACTTTGAGGTTGGT GGG Intergenic
No off target data available for this crispr