ID: 1044923863

View in Genome Browser
Species Human (GRCh38)
Location 8:97193071-97193093
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044923863_1044923867 9 Left 1044923863 8:97193071-97193093 CCAGCCATGCTGCACTTGCTCCA No data
Right 1044923867 8:97193103-97193125 TTAGAGACAGCAACCTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044923863 Original CRISPR TGGAGCAAGTGCAGCATGGC TGG (reversed) Intergenic
No off target data available for this crispr