ID: 1044924096

View in Genome Browser
Species Human (GRCh38)
Location 8:97195180-97195202
Sequence AGTCATCAAAACCATCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044924089_1044924096 19 Left 1044924089 8:97195138-97195160 CCTGTCCCCAGTAACAACCTCTC No data
Right 1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG No data
1044924085_1044924096 25 Left 1044924085 8:97195132-97195154 CCCTCCCCTGTCCCCAGTAACAA No data
Right 1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG No data
1044924090_1044924096 14 Left 1044924090 8:97195143-97195165 CCCCAGTAACAACCTCTCCAAAC No data
Right 1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG No data
1044924095_1044924096 -3 Left 1044924095 8:97195160-97195182 CCAAACAGTATCAGGACTTGAGT No data
Right 1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG No data
1044924088_1044924096 20 Left 1044924088 8:97195137-97195159 CCCTGTCCCCAGTAACAACCTCT No data
Right 1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG No data
1044924092_1044924096 12 Left 1044924092 8:97195145-97195167 CCAGTAACAACCTCTCCAAACAG No data
Right 1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG No data
1044924091_1044924096 13 Left 1044924091 8:97195144-97195166 CCCAGTAACAACCTCTCCAAACA No data
Right 1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG No data
1044924086_1044924096 24 Left 1044924086 8:97195133-97195155 CCTCCCCTGTCCCCAGTAACAAC No data
Right 1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG No data
1044924094_1044924096 2 Left 1044924094 8:97195155-97195177 CCTCTCCAAACAGTATCAGGACT No data
Right 1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG No data
1044924087_1044924096 21 Left 1044924087 8:97195136-97195158 CCCCTGTCCCCAGTAACAACCTC No data
Right 1044924096 8:97195180-97195202 AGTCATCAAAACCATCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044924096 Original CRISPR AGTCATCAAAACCATCTTTG TGG Intergenic
No off target data available for this crispr