ID: 1044925825

View in Genome Browser
Species Human (GRCh38)
Location 8:97208075-97208097
Sequence CTCCATTTCCAGTGGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044925825_1044925832 -7 Left 1044925825 8:97208075-97208097 CCTTGGCCCCACTGGAAATGGAG No data
Right 1044925832 8:97208091-97208113 AATGGAGCTTTCTTTGCAGGGGG No data
1044925825_1044925834 15 Left 1044925825 8:97208075-97208097 CCTTGGCCCCACTGGAAATGGAG No data
Right 1044925834 8:97208113-97208135 GCTGACCTTGTTTTTGTAAAGGG No data
1044925825_1044925830 -9 Left 1044925825 8:97208075-97208097 CCTTGGCCCCACTGGAAATGGAG No data
Right 1044925830 8:97208089-97208111 GAAATGGAGCTTTCTTTGCAGGG No data
1044925825_1044925829 -10 Left 1044925825 8:97208075-97208097 CCTTGGCCCCACTGGAAATGGAG No data
Right 1044925829 8:97208088-97208110 GGAAATGGAGCTTTCTTTGCAGG No data
1044925825_1044925833 14 Left 1044925825 8:97208075-97208097 CCTTGGCCCCACTGGAAATGGAG No data
Right 1044925833 8:97208112-97208134 GGCTGACCTTGTTTTTGTAAAGG No data
1044925825_1044925831 -8 Left 1044925825 8:97208075-97208097 CCTTGGCCCCACTGGAAATGGAG No data
Right 1044925831 8:97208090-97208112 AAATGGAGCTTTCTTTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044925825 Original CRISPR CTCCATTTCCAGTGGGGCCA AGG (reversed) Intergenic
No off target data available for this crispr