ID: 1044927732

View in Genome Browser
Species Human (GRCh38)
Location 8:97223809-97223831
Sequence CAGGTTTAACACAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044927732_1044927743 26 Left 1044927732 8:97223809-97223831 CCCTCTTCCCTGTGTTAAACCTG No data
Right 1044927743 8:97223858-97223880 CCACACCCCCTGACCCTCCAGGG No data
1044927732_1044927741 25 Left 1044927732 8:97223809-97223831 CCCTCTTCCCTGTGTTAAACCTG No data
Right 1044927741 8:97223857-97223879 CCCACACCCCCTGACCCTCCAGG No data
1044927732_1044927744 27 Left 1044927732 8:97223809-97223831 CCCTCTTCCCTGTGTTAAACCTG No data
Right 1044927744 8:97223859-97223881 CACACCCCCTGACCCTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044927732 Original CRISPR CAGGTTTAACACAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr