ID: 1044930257

View in Genome Browser
Species Human (GRCh38)
Location 8:97245291-97245313
Sequence CTGGGGGAATGAAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044930257_1044930267 6 Left 1044930257 8:97245291-97245313 CCCCCTTCCCTTCATTCCCCCAG No data
Right 1044930267 8:97245320-97245342 GCTCACACCTCTCACGCTCTAGG No data
1044930257_1044930268 9 Left 1044930257 8:97245291-97245313 CCCCCTTCCCTTCATTCCCCCAG No data
Right 1044930268 8:97245323-97245345 CACACCTCTCACGCTCTAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044930257 Original CRISPR CTGGGGGAATGAAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr