ID: 1044930462

View in Genome Browser
Species Human (GRCh38)
Location 8:97247119-97247141
Sequence ATCAGGGCTCACCCTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044930457_1044930462 -5 Left 1044930457 8:97247101-97247123 CCCGATTGGTTTGATTTAATCAG No data
Right 1044930462 8:97247119-97247141 ATCAGGGCTCACCCTGGACCTGG No data
1044930453_1044930462 23 Left 1044930453 8:97247073-97247095 CCACACTTGACCCAGGAAATGTA No data
Right 1044930462 8:97247119-97247141 ATCAGGGCTCACCCTGGACCTGG No data
1044930458_1044930462 -6 Left 1044930458 8:97247102-97247124 CCGATTGGTTTGATTTAATCAGG No data
Right 1044930462 8:97247119-97247141 ATCAGGGCTCACCCTGGACCTGG No data
1044930454_1044930462 13 Left 1044930454 8:97247083-97247105 CCCAGGAAATGTAATATACCCGA No data
Right 1044930462 8:97247119-97247141 ATCAGGGCTCACCCTGGACCTGG No data
1044930455_1044930462 12 Left 1044930455 8:97247084-97247106 CCAGGAAATGTAATATACCCGAT No data
Right 1044930462 8:97247119-97247141 ATCAGGGCTCACCCTGGACCTGG No data
1044930452_1044930462 24 Left 1044930452 8:97247072-97247094 CCCACACTTGACCCAGGAAATGT No data
Right 1044930462 8:97247119-97247141 ATCAGGGCTCACCCTGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044930462 Original CRISPR ATCAGGGCTCACCCTGGACC TGG Intergenic
No off target data available for this crispr