ID: 1044931611

View in Genome Browser
Species Human (GRCh38)
Location 8:97257539-97257561
Sequence GTCACCACCCTGACATTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044931608_1044931611 -3 Left 1044931608 8:97257519-97257541 CCAATTGTAAGTGCTCCGGAGTC No data
Right 1044931611 8:97257539-97257561 GTCACCACCCTGACATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044931611 Original CRISPR GTCACCACCCTGACATTCCT GGG Intergenic
No off target data available for this crispr