ID: 1044931650

View in Genome Browser
Species Human (GRCh38)
Location 8:97257773-97257795
Sequence CACTGCCCAAATGCCCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044931645_1044931650 16 Left 1044931645 8:97257734-97257756 CCCATTTTGCAGATGAAGAAAGT No data
Right 1044931650 8:97257773-97257795 CACTGCCCAAATGCCCTTTCTGG No data
1044931644_1044931650 17 Left 1044931644 8:97257733-97257755 CCCCATTTTGCAGATGAAGAAAG No data
Right 1044931650 8:97257773-97257795 CACTGCCCAAATGCCCTTTCTGG No data
1044931646_1044931650 15 Left 1044931646 8:97257735-97257757 CCATTTTGCAGATGAAGAAAGTG No data
Right 1044931650 8:97257773-97257795 CACTGCCCAAATGCCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044931650 Original CRISPR CACTGCCCAAATGCCCTTTC TGG Intergenic
No off target data available for this crispr