ID: 1044934459

View in Genome Browser
Species Human (GRCh38)
Location 8:97279318-97279340
Sequence GGGGTGTATACAAATCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044934459_1044934465 24 Left 1044934459 8:97279318-97279340 CCTGGGTGATTTGTATACACCCC No data
Right 1044934465 8:97279365-97279387 AGGAATTATTTTTATACAGATGG No data
1044934459_1044934464 4 Left 1044934459 8:97279318-97279340 CCTGGGTGATTTGTATACACCCC No data
Right 1044934464 8:97279345-97279367 TTTAAGGAAACAATTTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044934459 Original CRISPR GGGGTGTATACAAATCACCC AGG (reversed) Intergenic
No off target data available for this crispr