ID: 1044942157

View in Genome Browser
Species Human (GRCh38)
Location 8:97354295-97354317
Sequence GAGCTAAGGCTGGCAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044942157_1044942162 23 Left 1044942157 8:97354295-97354317 CCTTTCTCTGCCAGCCTTAGCTC No data
Right 1044942162 8:97354341-97354363 CTGCTCCAGACACACTGACCTGG No data
1044942157_1044942164 28 Left 1044942157 8:97354295-97354317 CCTTTCTCTGCCAGCCTTAGCTC No data
Right 1044942164 8:97354346-97354368 CCAGACACACTGACCTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044942157 Original CRISPR GAGCTAAGGCTGGCAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr