ID: 1044942731

View in Genome Browser
Species Human (GRCh38)
Location 8:97359999-97360021
Sequence ACTAGTATATTAATTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044942731_1044942734 -3 Left 1044942731 8:97359999-97360021 CCATCAGGAATTAATATACTAGT No data
Right 1044942734 8:97360019-97360041 AGTAAGAGCTTTAGTGCAAGGGG No data
1044942731_1044942732 -5 Left 1044942731 8:97359999-97360021 CCATCAGGAATTAATATACTAGT No data
Right 1044942732 8:97360017-97360039 CTAGTAAGAGCTTTAGTGCAAGG No data
1044942731_1044942733 -4 Left 1044942731 8:97359999-97360021 CCATCAGGAATTAATATACTAGT No data
Right 1044942733 8:97360018-97360040 TAGTAAGAGCTTTAGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044942731 Original CRISPR ACTAGTATATTAATTCCTGA TGG (reversed) Intergenic
No off target data available for this crispr