ID: 1044942732

View in Genome Browser
Species Human (GRCh38)
Location 8:97360017-97360039
Sequence CTAGTAAGAGCTTTAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044942731_1044942732 -5 Left 1044942731 8:97359999-97360021 CCATCAGGAATTAATATACTAGT No data
Right 1044942732 8:97360017-97360039 CTAGTAAGAGCTTTAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044942732 Original CRISPR CTAGTAAGAGCTTTAGTGCA AGG Intergenic
No off target data available for this crispr