ID: 1044942734

View in Genome Browser
Species Human (GRCh38)
Location 8:97360019-97360041
Sequence AGTAAGAGCTTTAGTGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044942731_1044942734 -3 Left 1044942731 8:97359999-97360021 CCATCAGGAATTAATATACTAGT No data
Right 1044942734 8:97360019-97360041 AGTAAGAGCTTTAGTGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044942734 Original CRISPR AGTAAGAGCTTTAGTGCAAG GGG Intergenic
No off target data available for this crispr