ID: 1044952956

View in Genome Browser
Species Human (GRCh38)
Location 8:97451435-97451457
Sequence CTGTGTTGTGGGAAGGTTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044952956_1044952964 27 Left 1044952956 8:97451435-97451457 CCGGTAACCTTCCCACAACACAG No data
Right 1044952964 8:97451485-97451507 AGCTGAATATCTTGATAAAGCGG No data
1044952956_1044952963 2 Left 1044952956 8:97451435-97451457 CCGGTAACCTTCCCACAACACAG No data
Right 1044952963 8:97451460-97451482 GGGAGAGTACATATTTTTGGTGG No data
1044952956_1044952962 -1 Left 1044952956 8:97451435-97451457 CCGGTAACCTTCCCACAACACAG No data
Right 1044952962 8:97451457-97451479 GAAGGGAGAGTACATATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044952956 Original CRISPR CTGTGTTGTGGGAAGGTTAC CGG (reversed) Intergenic
No off target data available for this crispr