ID: 1044952962

View in Genome Browser
Species Human (GRCh38)
Location 8:97451457-97451479
Sequence GAAGGGAGAGTACATATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044952955_1044952962 0 Left 1044952955 8:97451434-97451456 CCCGGTAACCTTCCCACAACACA No data
Right 1044952962 8:97451457-97451479 GAAGGGAGAGTACATATTTTTGG No data
1044952954_1044952962 5 Left 1044952954 8:97451429-97451451 CCTCTCCCGGTAACCTTCCCACA No data
Right 1044952962 8:97451457-97451479 GAAGGGAGAGTACATATTTTTGG No data
1044952956_1044952962 -1 Left 1044952956 8:97451435-97451457 CCGGTAACCTTCCCACAACACAG No data
Right 1044952962 8:97451457-97451479 GAAGGGAGAGTACATATTTTTGG No data
1044952959_1044952962 -8 Left 1044952959 8:97451442-97451464 CCTTCCCACAACACAGAAGGGAG No data
Right 1044952962 8:97451457-97451479 GAAGGGAGAGTACATATTTTTGG No data
1044952953_1044952962 6 Left 1044952953 8:97451428-97451450 CCCTCTCCCGGTAACCTTCCCAC No data
Right 1044952962 8:97451457-97451479 GAAGGGAGAGTACATATTTTTGG No data
1044952952_1044952962 15 Left 1044952952 8:97451419-97451441 CCTGGGCTGCCCTCTCCCGGTAA No data
Right 1044952962 8:97451457-97451479 GAAGGGAGAGTACATATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044952962 Original CRISPR GAAGGGAGAGTACATATTTT TGG Intergenic
No off target data available for this crispr