ID: 1044952963

View in Genome Browser
Species Human (GRCh38)
Location 8:97451460-97451482
Sequence GGGAGAGTACATATTTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044952954_1044952963 8 Left 1044952954 8:97451429-97451451 CCTCTCCCGGTAACCTTCCCACA No data
Right 1044952963 8:97451460-97451482 GGGAGAGTACATATTTTTGGTGG No data
1044952959_1044952963 -5 Left 1044952959 8:97451442-97451464 CCTTCCCACAACACAGAAGGGAG No data
Right 1044952963 8:97451460-97451482 GGGAGAGTACATATTTTTGGTGG No data
1044952955_1044952963 3 Left 1044952955 8:97451434-97451456 CCCGGTAACCTTCCCACAACACA No data
Right 1044952963 8:97451460-97451482 GGGAGAGTACATATTTTTGGTGG No data
1044952953_1044952963 9 Left 1044952953 8:97451428-97451450 CCCTCTCCCGGTAACCTTCCCAC No data
Right 1044952963 8:97451460-97451482 GGGAGAGTACATATTTTTGGTGG No data
1044952961_1044952963 -10 Left 1044952961 8:97451447-97451469 CCACAACACAGAAGGGAGAGTAC No data
Right 1044952963 8:97451460-97451482 GGGAGAGTACATATTTTTGGTGG No data
1044952960_1044952963 -9 Left 1044952960 8:97451446-97451468 CCCACAACACAGAAGGGAGAGTA No data
Right 1044952963 8:97451460-97451482 GGGAGAGTACATATTTTTGGTGG No data
1044952952_1044952963 18 Left 1044952952 8:97451419-97451441 CCTGGGCTGCCCTCTCCCGGTAA No data
Right 1044952963 8:97451460-97451482 GGGAGAGTACATATTTTTGGTGG No data
1044952956_1044952963 2 Left 1044952956 8:97451435-97451457 CCGGTAACCTTCCCACAACACAG No data
Right 1044952963 8:97451460-97451482 GGGAGAGTACATATTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044952963 Original CRISPR GGGAGAGTACATATTTTTGG TGG Intergenic
No off target data available for this crispr