ID: 1044952964

View in Genome Browser
Species Human (GRCh38)
Location 8:97451485-97451507
Sequence AGCTGAATATCTTGATAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044952956_1044952964 27 Left 1044952956 8:97451435-97451457 CCGGTAACCTTCCCACAACACAG No data
Right 1044952964 8:97451485-97451507 AGCTGAATATCTTGATAAAGCGG No data
1044952960_1044952964 16 Left 1044952960 8:97451446-97451468 CCCACAACACAGAAGGGAGAGTA No data
Right 1044952964 8:97451485-97451507 AGCTGAATATCTTGATAAAGCGG No data
1044952959_1044952964 20 Left 1044952959 8:97451442-97451464 CCTTCCCACAACACAGAAGGGAG No data
Right 1044952964 8:97451485-97451507 AGCTGAATATCTTGATAAAGCGG No data
1044952955_1044952964 28 Left 1044952955 8:97451434-97451456 CCCGGTAACCTTCCCACAACACA No data
Right 1044952964 8:97451485-97451507 AGCTGAATATCTTGATAAAGCGG No data
1044952961_1044952964 15 Left 1044952961 8:97451447-97451469 CCACAACACAGAAGGGAGAGTAC No data
Right 1044952964 8:97451485-97451507 AGCTGAATATCTTGATAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044952964 Original CRISPR AGCTGAATATCTTGATAAAG CGG Intergenic
No off target data available for this crispr