ID: 1044954852

View in Genome Browser
Species Human (GRCh38)
Location 8:97469418-97469440
Sequence CCTCATCTGTAAAATGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044954847_1044954852 27 Left 1044954847 8:97469368-97469390 CCTAAATCTGCTAGATGTGGAAA No data
Right 1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG 0: 15
1: 99
2: 349
3: 811
4: 1556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044954852 Original CRISPR CCTCATCTGTAAAATGGGGA CGG Intergenic
Too many off-targets to display for this crispr