ID: 1044954852 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:97469418-97469440 |
| Sequence | CCTCATCTGTAAAATGGGGA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2830 | |||
| Summary | {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1044954847_1044954852 | 27 | Left | 1044954847 | 8:97469368-97469390 | CCTAAATCTGCTAGATGTGGAAA | No data | ||
| Right | 1044954852 | 8:97469418-97469440 | CCTCATCTGTAAAATGGGGACGG | 0: 15 1: 99 2: 349 3: 811 4: 1556 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1044954852 | Original CRISPR | CCTCATCTGTAAAATGGGGA CGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||