ID: 1044957716

View in Genome Browser
Species Human (GRCh38)
Location 8:97498715-97498737
Sequence GATGTGGAAGAGTCCACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044957716_1044957719 25 Left 1044957716 8:97498715-97498737 CCTCCAGTGGACTCTTCCACATC No data
Right 1044957719 8:97498763-97498785 TTTAGAAATTCTCTAACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044957716 Original CRISPR GATGTGGAAGAGTCCACTGG AGG (reversed) Intergenic
No off target data available for this crispr