ID: 1044964396

View in Genome Browser
Species Human (GRCh38)
Location 8:97561095-97561117
Sequence TCCGCCCACATGATTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044964396_1044964401 11 Left 1044964396 8:97561095-97561117 CCCCCAAAAATCATGTGGGCGGA No data
Right 1044964401 8:97561129-97561151 CAGGACAGACATTCCAATGCTGG No data
1044964396_1044964400 -8 Left 1044964396 8:97561095-97561117 CCCCCAAAAATCATGTGGGCGGA No data
Right 1044964400 8:97561110-97561132 TGGGCGGAGCTCATGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044964396 Original CRISPR TCCGCCCACATGATTTTTGG GGG (reversed) Intergenic
No off target data available for this crispr