ID: 1044964400

View in Genome Browser
Species Human (GRCh38)
Location 8:97561110-97561132
Sequence TGGGCGGAGCTCATGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044964389_1044964400 18 Left 1044964389 8:97561069-97561091 CCTCTCCAGGTTTCTAGAGGCTA No data
Right 1044964400 8:97561110-97561132 TGGGCGGAGCTCATGAGTGCAGG No data
1044964391_1044964400 13 Left 1044964391 8:97561074-97561096 CCAGGTTTCTAGAGGCTAGGCCC No data
Right 1044964400 8:97561110-97561132 TGGGCGGAGCTCATGAGTGCAGG No data
1044964398_1044964400 -10 Left 1044964398 8:97561097-97561119 CCCAAAAATCATGTGGGCGGAGC No data
Right 1044964400 8:97561110-97561132 TGGGCGGAGCTCATGAGTGCAGG No data
1044964387_1044964400 21 Left 1044964387 8:97561066-97561088 CCACCTCTCCAGGTTTCTAGAGG No data
Right 1044964400 8:97561110-97561132 TGGGCGGAGCTCATGAGTGCAGG No data
1044964394_1044964400 -7 Left 1044964394 8:97561094-97561116 CCCCCCAAAAATCATGTGGGCGG No data
Right 1044964400 8:97561110-97561132 TGGGCGGAGCTCATGAGTGCAGG No data
1044964396_1044964400 -8 Left 1044964396 8:97561095-97561117 CCCCCAAAAATCATGTGGGCGGA No data
Right 1044964400 8:97561110-97561132 TGGGCGGAGCTCATGAGTGCAGG No data
1044964397_1044964400 -9 Left 1044964397 8:97561096-97561118 CCCCAAAAATCATGTGGGCGGAG No data
Right 1044964400 8:97561110-97561132 TGGGCGGAGCTCATGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044964400 Original CRISPR TGGGCGGAGCTCATGAGTGC AGG Intergenic
No off target data available for this crispr