ID: 1044964401

View in Genome Browser
Species Human (GRCh38)
Location 8:97561129-97561151
Sequence CAGGACAGACATTCCAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044964394_1044964401 12 Left 1044964394 8:97561094-97561116 CCCCCCAAAAATCATGTGGGCGG No data
Right 1044964401 8:97561129-97561151 CAGGACAGACATTCCAATGCTGG No data
1044964398_1044964401 9 Left 1044964398 8:97561097-97561119 CCCAAAAATCATGTGGGCGGAGC No data
Right 1044964401 8:97561129-97561151 CAGGACAGACATTCCAATGCTGG No data
1044964396_1044964401 11 Left 1044964396 8:97561095-97561117 CCCCCAAAAATCATGTGGGCGGA No data
Right 1044964401 8:97561129-97561151 CAGGACAGACATTCCAATGCTGG No data
1044964399_1044964401 8 Left 1044964399 8:97561098-97561120 CCAAAAATCATGTGGGCGGAGCT No data
Right 1044964401 8:97561129-97561151 CAGGACAGACATTCCAATGCTGG No data
1044964397_1044964401 10 Left 1044964397 8:97561096-97561118 CCCCAAAAATCATGTGGGCGGAG No data
Right 1044964401 8:97561129-97561151 CAGGACAGACATTCCAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044964401 Original CRISPR CAGGACAGACATTCCAATGC TGG Intergenic
No off target data available for this crispr