ID: 1044971455

View in Genome Browser
Species Human (GRCh38)
Location 8:97624466-97624488
Sequence TCGAGGCGATGCCAGCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044971450_1044971455 7 Left 1044971450 8:97624436-97624458 CCATCATCAGCAGCTTCTTAGCT 0: 1
1: 0
2: 3
3: 19
4: 197
Right 1044971455 8:97624466-97624488 TCGAGGCGATGCCAGCGCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 79
1044971449_1044971455 11 Left 1044971449 8:97624432-97624454 CCGGCCATCATCAGCAGCTTCTT No data
Right 1044971455 8:97624466-97624488 TCGAGGCGATGCCAGCGCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044971455 Original CRISPR TCGAGGCGATGCCAGCGCCC CGG Intergenic
900386333 1:2412644-2412666 TGGAGGCGGGGCCAGGGCCCGGG + Intronic
900403256 1:2481471-2481493 TTGAGGCTGTGCCAGGGCCCGGG + Intronic
903847938 1:26289609-26289631 TCATGGCGATGCCCACGCCCAGG + Intronic
908561326 1:65309557-65309579 GCGAGGCGAAGCCGCCGCCCTGG - Exonic
912388121 1:109282827-109282849 TGGAGGCAAAGCAAGCGCCCAGG + Intronic
913200451 1:116491897-116491919 TAGGGGCGATGGCAGAGCCCGGG - Intergenic
919761407 1:201100387-201100409 TTGTGGAGATGCCAGGGCCCTGG - Intronic
921023880 1:211259831-211259853 TCGAGGCTACCGCAGCGCCCAGG - Intronic
923268645 1:232335369-232335391 CAGTGGCGATGCCAGCACCCCGG - Intergenic
1064643225 10:17435043-17435065 TCAGGGGGATGCCAGCCCCCTGG + Intronic
1073105988 10:101032271-101032293 TCGAGGCGATGCCCCCAGCCTGG - Intronic
1073444791 10:103574238-103574260 TCCAGACGATGCAAGCGCTCAGG + Intronic
1074479588 10:113807084-113807106 ACGAGGCTATGCCAGCCACCTGG + Intergenic
1076722385 10:132398423-132398445 TGGAGGGGATGGCAGCTCCCAGG - Intronic
1092945513 12:13450605-13450627 TCCAGGACATGCCAGGGCCCTGG + Intergenic
1096155600 12:49339763-49339785 TCGAGGCAATGCTGGGGCCCAGG + Intergenic
1101947738 12:109150660-109150682 TGGGGGCGATGCCAGGTCCCTGG - Intronic
1102762879 12:115404243-115404265 TCTAGGTGATCCCAGCTCCCAGG - Intergenic
1103415177 12:120738477-120738499 TTGAGGCCAGGCCCGCGCCCCGG + Intronic
1103537238 12:121641433-121641455 TCGAGGCGATGGCAGCTGCCTGG - Exonic
1103547444 12:121712395-121712417 TTGAGCCCAGGCCAGCGCCCCGG - Intergenic
1105413748 13:20192554-20192576 TGGACGCGATGGCACCGCCCGGG - Intronic
1113706401 13:112436097-112436119 TGGAGGCGATGCCTGCCTCCTGG - Intergenic
1114690376 14:24574913-24574935 TCGAGGGGATGGGAGGGCCCTGG + Intronic
1119473414 14:74912984-74913006 TGGAGGCAAGGCCAGCACCCTGG + Intronic
1130928759 15:88405264-88405286 TGGAAGCTATGCCAGAGCCCTGG - Intergenic
1132754352 16:1475303-1475325 TCGGGGCGAGGGAAGCGCCCGGG + Exonic
1136551638 16:30985303-30985325 CAGAGGCGCTGCCAGTGCCCAGG + Intronic
1141499824 16:84436348-84436370 ACGTGGCGATCCCAGAGCCCAGG - Intronic
1145285838 17:21505579-21505601 TCCAGGCGCTCCCAGCCCCCTGG + Intergenic
1146978845 17:37140871-37140893 CCGAGATGATGCCAGTGCCCCGG + Intronic
1147200829 17:38799920-38799942 TGGCGGCGATGCCACCGCTCCGG + Intronic
1151919361 17:77141497-77141519 TCGAGGGGCGGCCGGCGCCCGGG - Intronic
1160742042 19:690903-690925 CCCAGACGATGCCAGCGCCCCGG - Intronic
1160873947 19:1288713-1288735 GAGAGGCGATGCCTGCACCCAGG + Intronic
1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG + Intergenic
1164464643 19:28476950-28476972 TTGAGGCGATGCCACAGCCCTGG + Intergenic
927958669 2:27225770-27225792 TAGAGGCAAAGCCAGAGCCCAGG - Exonic
928397708 2:30955698-30955720 TCGGGGCGCTGACATCGCCCAGG - Exonic
934710561 2:96511385-96511407 GGGAGGTGATGCCAGGGCCCCGG + Intergenic
934846366 2:97663698-97663720 CCGGGGCGAAGCCAGCGGCCCGG + Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
943367458 2:186979806-186979828 TTAAGGCCATGCCAGCCCCCAGG - Intergenic
946467988 2:219929520-219929542 TCCAGGTGATTCCAGAGCCCAGG - Intergenic
948438118 2:237967367-237967389 GCCGGGCGAGGCCAGCGCCCCGG - Intronic
1169000263 20:2163309-2163331 GCAAGGCCATGCCAGCTCCCGGG + Intronic
1175726908 20:61324749-61324771 TGGAGGAGATTCTAGCGCCCAGG + Intronic
1179140409 21:38720119-38720141 TCAAGGCGTTGTCAGGGCCCTGG + Intergenic
1180757225 22:18170465-18170487 TCCAGGCGAGACCAGCTCCCTGG + Intronic
1181074552 22:20367000-20367022 TCGGGGCGAGACCAGCTCCCTGG - Intronic
1181711596 22:24695089-24695111 TTGAGGTGATGTCAGTGCCCAGG - Intergenic
1184037755 22:41926554-41926576 TCGGGGCTCTGCCTGCGCCCTGG + Intronic
1184115365 22:42418843-42418865 GCCAGGCCAGGCCAGCGCCCGGG - Intronic
949522369 3:4868660-4868682 ACGCGGCGAAGCCGGCGCCCCGG - Intronic
951299287 3:20974657-20974679 TATAGGAGATGCCAGCTCCCTGG + Intergenic
954407963 3:50355936-50355958 TGGATGTGATGCCAGCACCCAGG - Intronic
954704437 3:52471682-52471704 TCAGGGCAAAGCCAGCGCCCTGG - Intronic
965166098 3:165195824-165195846 GCGCGGCGATGCCAGCGACAGGG + Exonic
965735055 3:171810580-171810602 GCGAGGCGGTGCCAGGTCCCGGG + Intronic
968382278 4:107414-107436 ACGAGGCGTTCCCAGGGCCCCGG + Intergenic
979116141 4:116826722-116826744 TCCAGGCCATGTCAGAGCCCTGG - Intergenic
985556045 5:558505-558527 TGGAGGCGATCCCTGCGGCCTGG + Intergenic
1004526179 6:16410127-16410149 CCGAGGCAGTGCCAGCACCCAGG - Intronic
1018059399 6:160078857-160078879 TCCATGCCATGCCAGAGCCCTGG + Intronic
1026763503 7:73144330-73144352 TCCAGGCGACCCCAGCCCCCAGG + Intergenic
1027039973 7:74954104-74954126 TCCAGGCGACCCCAGCCCCCAGG + Intergenic
1027083666 7:75248260-75248282 TCCAGGCGACCCCAGCCCCCAGG - Intergenic
1033452044 7:141470864-141470886 TCAAGACGATGCCAGTGCCAAGG + Exonic
1035052119 7:156005009-156005031 GCGAGGCCAAGCCTGCGCCCCGG - Intergenic
1036803266 8:11808601-11808623 GCGGGGCGGTGCCTGCGCCCGGG - Intronic
1037473874 8:19237562-19237584 TCCAGCCGCGGCCAGCGCCCGGG - Intergenic
1038156183 8:24992580-24992602 TGGGGGCAATGCCAGTGCCCAGG + Intergenic
1039453716 8:37695273-37695295 CCGAGGCGAGGCCTGCCCCCAGG + Intergenic
1040538499 8:48330465-48330487 TGGAGCCCATGCCAGTGCCCCGG - Intergenic
1044971455 8:97624466-97624488 TCGAGGCGATGCCAGCGCCCCGG + Intergenic
1048260015 8:132937299-132937321 TGGAGACGATGCCACAGCCCAGG + Intronic
1053447585 9:38164726-38164748 CGGAGGGGATGCCAGCCCCCAGG - Intergenic
1057208204 9:93185405-93185427 CCGAGGCGAAGCCTGAGCCCGGG + Exonic
1062384189 9:136302582-136302604 CGGTGGAGATGCCAGCGCCCAGG - Intronic
1186443648 X:9607422-9607444 TCCAGGCGATGCAAGTGCCAGGG - Intronic
1200043073 X:153384056-153384078 TCAAGGCGAGGTCTGCGCCCTGG + Intergenic
1200687613 Y:6270795-6270817 TCAAAGCCATGCCAGGGCCCTGG - Intergenic
1201047658 Y:9903914-9903936 TCAAAGCCATGCCAGGGCCCTGG + Intergenic