ID: 1044973776

View in Genome Browser
Species Human (GRCh38)
Location 8:97644338-97644360
Sequence CGCTGCCACCGCGGGGAGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044973776_1044973790 7 Left 1044973776 8:97644338-97644360 CCGCCCTCCCCGCGGTGGCAGCG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1044973790 8:97644368-97644390 CCCGGCTCCGGCGCGAGGGACGG 0: 1
1: 0
2: 0
3: 24
4: 111
1044973776_1044973784 -5 Left 1044973776 8:97644338-97644360 CCGCCCTCCCCGCGGTGGCAGCG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1044973784 8:97644356-97644378 CAGCGGCCGATCCCCGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 100
1044973776_1044973794 29 Left 1044973776 8:97644338-97644360 CCGCCCTCCCCGCGGTGGCAGCG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1044973794 8:97644390-97644412 GCCGCGATGCGCTCGGCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 61
1044973776_1044973786 2 Left 1044973776 8:97644338-97644360 CCGCCCTCCCCGCGGTGGCAGCG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1044973786 8:97644363-97644385 CGATCCCCGGCTCCGGCGCGAGG 0: 1
1: 0
2: 0
3: 12
4: 115
1044973776_1044973787 3 Left 1044973776 8:97644338-97644360 CCGCCCTCCCCGCGGTGGCAGCG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1044973787 8:97644364-97644386 GATCCCCGGCTCCGGCGCGAGGG 0: 1
1: 0
2: 0
3: 4
4: 53
1044973776_1044973793 22 Left 1044973776 8:97644338-97644360 CCGCCCTCCCCGCGGTGGCAGCG 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1044973793 8:97644383-97644405 AGGGACGGCCGCGATGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044973776 Original CRISPR CGCTGCCACCGCGGGGAGGG CGG (reversed) Exonic