ID: 1044974824

View in Genome Browser
Species Human (GRCh38)
Location 8:97654033-97654055
Sequence CAGGGTTACCTTTATGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044974824_1044974828 2 Left 1044974824 8:97654033-97654055 CCCATCTCATAAAGGTAACCCTG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1044974828 8:97654058-97654080 CATCCCTGCTGTAGTCAACAAGG No data
1044974824_1044974831 13 Left 1044974824 8:97654033-97654055 CCCATCTCATAAAGGTAACCCTG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1044974831 8:97654069-97654091 TAGTCAACAAGGAGACAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044974824 Original CRISPR CAGGGTTACCTTTATGAGAT GGG (reversed) Intronic
908734798 1:67264919-67264941 CTGGGCTACTTTTATGAGACGGG + Intergenic
909466536 1:75979811-75979833 CAGGTATACCTTCTTGAGATGGG + Intergenic
910107985 1:83652259-83652281 CTGGGAGACCTCTATGAGATTGG + Intergenic
910130484 1:83899055-83899077 CAGGGTTAACTTTATAAAAATGG + Intronic
920227556 1:204449524-204449546 CAGGGATGCCTTCATGAGGTGGG + Intronic
922093190 1:222417289-222417311 CGCAGTTACCTTTATGATATTGG + Intergenic
923326151 1:232882011-232882033 CAGGGTTTCCTTGAAGTGATGGG - Intergenic
1064447524 10:15408811-15408833 CAGTGTGAGTTTTATGAGATTGG + Intergenic
1065791344 10:29263463-29263485 CAGGTTTGCCTGCATGAGATGGG - Intergenic
1066095541 10:32068766-32068788 CAGGGATTCCTCCATGAGATCGG - Intergenic
1068055095 10:52003161-52003183 CAGTGCTACTTTTAAGAGATAGG + Intronic
1069149988 10:64948158-64948180 CACGGTGACCTGGATGAGATTGG - Intergenic
1069261643 10:66405470-66405492 CAGTGTTTCCTTTTTAAGATTGG + Intronic
1070165484 10:73894461-73894483 CATGGTTTCCTCTGTGAGATGGG - Intergenic
1074770706 10:116731770-116731792 AAGGGTTACCTTGCTGAGAGAGG - Intronic
1076980258 11:200360-200382 CAGGGTCAGCTTGGTGAGATGGG + Intronic
1078010485 11:7569687-7569709 CAGTGTTACCCTCAGGAGATGGG + Intronic
1080931365 11:36814851-36814873 CAGGTCTACCTTCATGAGAGTGG - Intergenic
1087088577 11:94244789-94244811 CAGGTTCACTTTTATGAGCTGGG + Intergenic
1091197810 11:133746926-133746948 CAGGGTTACTTTTATGACAAAGG - Intergenic
1093515502 12:19981586-19981608 AAGGGTTAAATTTATGATATAGG - Intergenic
1097579000 12:61430780-61430802 CAGGGTGACCTAAATGATATGGG + Intergenic
1101567194 12:105919251-105919273 CAGGATGACATTTAAGAGATAGG - Intergenic
1103811092 12:123614520-123614542 CAGGGTGAACTTTATTAGAAGGG + Intronic
1105358399 13:19681655-19681677 CAGGGTTTCCTTTCGGAGAAAGG + Intronic
1107559124 13:41544824-41544846 CTGGGTTCCCTTTTTGAGAAAGG + Intergenic
1111126396 13:83914305-83914327 CAAGGTTATGTTTATGAGAGGGG + Intergenic
1115081388 14:29455424-29455446 CAGGGCTAGCTTTATAAGATTGG - Intergenic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1124507694 15:30292575-30292597 CAGGTTTACATATATGAGACTGG + Intergenic
1124735862 15:32246083-32246105 CAGGTTTACATATATGAGACTGG - Intergenic
1125271985 15:37949628-37949650 AATGGTTATCTGTATGAGATTGG + Intronic
1128230483 15:66031318-66031340 CTGGTTTCCCTTTGTGAGATAGG + Intronic
1130271315 15:82450684-82450706 AATGGTTATCTGTATGAGATTGG - Intergenic
1130489019 15:84416763-84416785 AATGGTTATCTGTATGAGATTGG + Intergenic
1132473850 16:122445-122467 CAGAGTTATATTCATGAGATTGG + Intronic
1132916758 16:2352270-2352292 CAGGGGTACCTTTATCTAATTGG - Intergenic
1134395571 16:13859855-13859877 CAGAGTGACCTTGTTGAGATCGG + Intergenic
1137622127 16:49883060-49883082 CAAGGTTACCTCTATGAGGATGG + Intergenic
1144370753 17:14589431-14589453 CAGAATTATCTTTATTAGATTGG + Intergenic
1157742625 18:50106888-50106910 CAGGGTTTTCTTTATGAGGTGGG - Intronic
1160099992 18:75911618-75911640 AAGGTTTACCTTTAAAAGATGGG - Intergenic
1164567651 19:29339406-29339428 GAGGGTTGCCTTGATGAGAAAGG + Intergenic
1164761625 19:30732686-30732708 CATGGTTACCTTTAGGATGTTGG - Intergenic
1164761643 19:30732791-30732813 CATGGTTACCTTTAGGATGTTGG - Intergenic
1164761696 19:30733078-30733100 CATGGTTACCTTTAGGATGTGGG - Intergenic
1165385361 19:35507418-35507440 CAGGGTTGGCTTTAGGAGAAGGG - Intronic
1167982261 19:53284740-53284762 CAGTGTCACCTTCATGAGAGGGG + Intergenic
1167983884 19:53299233-53299255 CAGTGTCACCTTCATGAGAGGGG - Intergenic
929368521 2:41192292-41192314 AAGGGTTGACTTTATGATATTGG - Intergenic
930624323 2:53679642-53679664 CAGAGTTTTCTTTTTGAGATGGG - Intronic
940616827 2:156059330-156059352 GAAGGTTACCTTTAGGAGAGGGG - Intergenic
946636354 2:221732082-221732104 CAGAGAGACCTTTAAGAGATGGG + Intergenic
1169516693 20:6324038-6324060 CAAGGTTACTTTTTAGAGATAGG - Intergenic
1177115079 21:17075377-17075399 CAGGGTTCCCATGATGGGATTGG - Intergenic
1178098309 21:29238895-29238917 CAAGATTCCTTTTATGAGATGGG + Intronic
1179290173 21:40011605-40011627 CAGGGTTTGCTTTATGAAAGAGG - Exonic
949708645 3:6848154-6848176 TTGGGTTACCTTTAACAGATTGG + Intronic
952101738 3:30021352-30021374 CAGAGTGACCTGGATGAGATTGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955545955 3:60030488-60030510 GAGGGATACCTTCATGGGATGGG - Intronic
963246165 3:143065402-143065424 GAGGGGTACCTTTCTTAGATAGG + Intergenic
963391987 3:144676248-144676270 CGGCGTTACCTTTAGGAGACTGG + Intergenic
970996594 4:22274718-22274740 CACGGTGACCTGGATGAGATCGG + Intergenic
971835969 4:31762955-31762977 CAGGGTTACCTTCGGGAGAGTGG + Intergenic
972188606 4:36563232-36563254 CAGAGTGACCTGGATGAGATTGG - Intergenic
972213503 4:36867755-36867777 CAGGATTCCCTTTATCAAATAGG + Intergenic
973671796 4:53226947-53226969 TAGGGATACCTTTTTTAGATCGG - Intronic
983147867 4:164240871-164240893 CAGGGTTAGAATTATGAGAGAGG + Intronic
985635198 5:1032449-1032471 AAGCGTTACCTTTATGTGTTTGG + Intronic
987245394 5:16043125-16043147 CAGGATGACCTTTCTGAGCTAGG - Intergenic
988599967 5:32630804-32630826 TAGGGTGACCATTATGTGATAGG + Intergenic
995676533 5:114668726-114668748 AATGGTTACCTTTATCACATTGG - Intergenic
996489962 5:124082749-124082771 CATGGATACCATAATGAGATTGG + Intergenic
997872151 5:137515817-137515839 CAGCTATAACTTTATGAGATAGG + Intronic
999486400 5:152001141-152001163 TAGGGTTAGCTATATGAGAATGG + Intergenic
1000114049 5:158136372-158136394 CATTTTTAACTTTATGAGATAGG + Intergenic
1000703595 5:164483408-164483430 GAGGATTATCTTCATGAGATGGG + Intergenic
1003876660 6:10443647-10443669 AAGGGTTACCTTTGGGAGTTGGG + Intergenic
1004047338 6:12039169-12039191 CAGGATTACCTTTTTCAAATTGG + Intronic
1004204057 6:13574889-13574911 CAGGGTGACCTTTCTGAAAAGGG - Intronic
1004504854 6:16239272-16239294 CAGGGTTTCCTTTCTGAGTTTGG + Intronic
1005117323 6:22353233-22353255 CAGAGATACATTTATCAGATAGG - Intergenic
1005168827 6:22957646-22957668 GAGGGTTAACTGTCTGAGATAGG - Intergenic
1005516884 6:26563604-26563626 CAGAGTAACCCTAATGAGATAGG - Intergenic
1009595585 6:65731096-65731118 CAGGGTTCCATTTAGGGGATAGG + Intergenic
1018202628 6:161409883-161409905 CAGGGTAAACTTTATGAGAATGG - Intronic
1018676201 6:166224186-166224208 CAGGGGTCTCTTTATGAGAGGGG + Intergenic
1020857896 7:13451893-13451915 TTGGCTTACCTTTATGGGATGGG + Intergenic
1032759779 7:134929119-134929141 CTGGGGTATGTTTATGAGATGGG - Intronic
1034482675 7:151334758-151334780 CCAGGTTAGGTTTATGAGATGGG + Intergenic
1035048258 7:155983297-155983319 CAGGGTTGCCTTTGTGTGAAAGG - Intergenic
1041695481 8:60731736-60731758 TAGGTTTACCTTTTTGAGATTGG + Intronic
1044974824 8:97654033-97654055 CAGGGTTACCTTTATGAGATGGG - Intronic
1046710070 8:117500768-117500790 CAGGATTATTTTTCTGAGATAGG - Intergenic
1046929811 8:119830769-119830791 TAGGGCTACCTTTATTACATAGG - Intronic
1050260058 9:3831749-3831771 CAGTGGTACATTTATGTGATGGG + Intronic
1054375316 9:64445007-64445029 CATGGCTGCCTTTATGAGCTGGG + Intergenic
1055141050 9:72877369-72877391 CAGGGTTAGGATTATGAGAGGGG - Intergenic
1062171373 9:135136738-135136760 CAGGGGCACCTTCATGACATCGG + Intergenic
1062226449 9:135455153-135455175 TAGGGTCACCTTTCTGAGCTGGG - Intergenic
1062705929 9:137942665-137942687 CACAGTGACCTTGATGAGATTGG + Intronic
1186252780 X:7686907-7686929 AAGTGTTTCCTTTTTGAGATTGG - Intergenic
1202371539 Y:24200596-24200618 AATGGTTATCTGTATGAGATTGG + Intergenic
1202499246 Y:25469520-25469542 AATGGTTATCTGTATGAGATTGG - Intergenic