ID: 1044988295

View in Genome Browser
Species Human (GRCh38)
Location 8:97774203-97774225
Sequence CGGCGAACAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044988286_1044988295 23 Left 1044988286 8:97774157-97774179 CCTGCCGGATCCAGAGGGGTGGA 0: 12
1: 51
2: 119
3: 150
4: 212
Right 1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG No data
1044988289_1044988295 13 Left 1044988289 8:97774167-97774189 CCAGAGGGGTGGAAGTCAACGGC No data
Right 1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG No data
1044988287_1044988295 19 Left 1044988287 8:97774161-97774183 CCGGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG No data
1044988284_1044988295 24 Left 1044988284 8:97774156-97774178 CCCTGCCGGATCCAGAGGGGTGG 0: 12
1: 57
2: 117
3: 172
4: 193
Right 1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044988295 Original CRISPR CGGCGAACAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr