ID: 1044990088

View in Genome Browser
Species Human (GRCh38)
Location 8:97788142-97788164
Sequence TTGCTGTGGGAAGATGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044990079_1044990088 21 Left 1044990079 8:97788098-97788120 CCAATAAAACGTCCAACTGTCCA 0: 1
1: 1
2: 0
3: 7
4: 81
Right 1044990088 8:97788142-97788164 TTGCTGTGGGAAGATGGTGATGG No data
1044990083_1044990088 1 Left 1044990083 8:97788118-97788140 CCAGATGGTGGCGCCATTTTCAG 0: 1
1: 0
2: 1
3: 34
4: 101
Right 1044990088 8:97788142-97788164 TTGCTGTGGGAAGATGGTGATGG No data
1044990078_1044990088 22 Left 1044990078 8:97788097-97788119 CCCAATAAAACGTCCAACTGTCC 0: 1
1: 1
2: 0
3: 9
4: 75
Right 1044990088 8:97788142-97788164 TTGCTGTGGGAAGATGGTGATGG No data
1044990082_1044990088 9 Left 1044990082 8:97788110-97788132 CCAACTGTCCAGATGGTGGCGCC 0: 1
1: 0
2: 1
3: 29
4: 90
Right 1044990088 8:97788142-97788164 TTGCTGTGGGAAGATGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044990088 Original CRISPR TTGCTGTGGGAAGATGGTGA TGG Intronic
No off target data available for this crispr