ID: 1044992958

View in Genome Browser
Species Human (GRCh38)
Location 8:97812730-97812752
Sequence AACCCAAGACAACCTCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044992953_1044992958 18 Left 1044992953 8:97812689-97812711 CCTATGTGAGGAGCAGTGACATT 0: 1
1: 0
2: 2
3: 14
4: 139
Right 1044992958 8:97812730-97812752 AACCCAAGACAACCTCAGAGTGG No data
1044992952_1044992958 29 Left 1044992952 8:97812678-97812700 CCTAGATTTAACCTATGTGAGGA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1044992958 8:97812730-97812752 AACCCAAGACAACCTCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044992958 Original CRISPR AACCCAAGACAACCTCAGAG TGG Intronic
No off target data available for this crispr