ID: 1044993060 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:97813431-97813453 |
| Sequence | GTACCCATACAGATTGAGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1044993053_1044993060 | 15 | Left | 1044993053 | 8:97813393-97813415 | CCTGCTTTATTCTAGCCAGGCTG | 0: 3 1: 95 2: 217 3: 310 4: 410 |
||
| Right | 1044993060 | 8:97813431-97813453 | GTACCCATACAGATTGAGGGTGG | No data | ||||
| 1044993051_1044993060 | 19 | Left | 1044993051 | 8:97813389-97813411 | CCTACCTGCTTTATTCTAGCCAG | 0: 1 1: 3 2: 35 3: 56 4: 202 |
||
| Right | 1044993060 | 8:97813431-97813453 | GTACCCATACAGATTGAGGGTGG | No data | ||||
| 1044993056_1044993060 | 0 | Left | 1044993056 | 8:97813408-97813430 | CCAGGCTGGCAGCTGGTTAGATG | 0: 1 1: 13 2: 376 3: 704 4: 802 |
||
| Right | 1044993060 | 8:97813431-97813453 | GTACCCATACAGATTGAGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1044993060 | Original CRISPR | GTACCCATACAGATTGAGGG TGG | Intronic | ||
| No off target data available for this crispr | |||||