ID: 1044993060

View in Genome Browser
Species Human (GRCh38)
Location 8:97813431-97813453
Sequence GTACCCATACAGATTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044993053_1044993060 15 Left 1044993053 8:97813393-97813415 CCTGCTTTATTCTAGCCAGGCTG 0: 3
1: 95
2: 217
3: 310
4: 410
Right 1044993060 8:97813431-97813453 GTACCCATACAGATTGAGGGTGG No data
1044993051_1044993060 19 Left 1044993051 8:97813389-97813411 CCTACCTGCTTTATTCTAGCCAG 0: 1
1: 3
2: 35
3: 56
4: 202
Right 1044993060 8:97813431-97813453 GTACCCATACAGATTGAGGGTGG No data
1044993056_1044993060 0 Left 1044993056 8:97813408-97813430 CCAGGCTGGCAGCTGGTTAGATG 0: 1
1: 13
2: 376
3: 704
4: 802
Right 1044993060 8:97813431-97813453 GTACCCATACAGATTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044993060 Original CRISPR GTACCCATACAGATTGAGGG TGG Intronic
No off target data available for this crispr