ID: 1044995639

View in Genome Browser
Species Human (GRCh38)
Location 8:97835694-97835716
Sequence GGCTCCAAGGCACCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044995639_1044995641 -9 Left 1044995639 8:97835694-97835716 CCTGCTGGTGGTGCCTTGGAGCC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1044995641 8:97835708-97835730 CTTGGAGCCCCCTTTCTTTTAGG No data
1044995639_1044995642 -8 Left 1044995639 8:97835694-97835716 CCTGCTGGTGGTGCCTTGGAGCC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1044995642 8:97835709-97835731 TTGGAGCCCCCTTTCTTTTAGGG No data
1044995639_1044995649 18 Left 1044995639 8:97835694-97835716 CCTGCTGGTGGTGCCTTGGAGCC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1044995649 8:97835735-97835757 TGTTATGAAAATCACATGGTGGG No data
1044995639_1044995647 14 Left 1044995639 8:97835694-97835716 CCTGCTGGTGGTGCCTTGGAGCC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1044995647 8:97835731-97835753 GCAGTGTTATGAAAATCACATGG No data
1044995639_1044995648 17 Left 1044995639 8:97835694-97835716 CCTGCTGGTGGTGCCTTGGAGCC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1044995648 8:97835734-97835756 GTGTTATGAAAATCACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044995639 Original CRISPR GGCTCCAAGGCACCACCAGC AGG (reversed) Intronic
900115924 1:1027907-1027929 GGCTCCCACGCACCCCCCGCTGG + Intronic
900876929 1:5349459-5349481 GACTCCATGGCACCAGCAACAGG + Intergenic
903423181 1:23233382-23233404 GTTTCCAAGGCACCACTAGTTGG + Intergenic
904306428 1:29593079-29593101 GGCTCCAACGCACCAGCTTCAGG - Intergenic
904918126 1:33985123-33985145 AGCTTCAAGGCTTCACCAGCAGG + Intronic
905393046 1:37650505-37650527 GGCCCCAAGGCACCAGCAGTGGG + Intergenic
913336076 1:117709982-117710004 GACTCCCAGGCATCACCAGGTGG + Intergenic
913445212 1:118943813-118943835 GGCTCCCAGGGAGCACGAGCAGG + Intronic
914716401 1:150258146-150258168 GGATCCAAATCACCTCCAGCAGG - Exonic
916416349 1:164595645-164595667 GGCTTCAAGAAACCACCAGTGGG + Intronic
917962896 1:180158471-180158493 GGATCCACGGCACCAGCAGAAGG - Intronic
919850123 1:201666851-201666873 GGCTCCTTGGCAGAACCAGCAGG + Intronic
920369509 1:205469249-205469271 AGGTCCAAGGCACCTCCTGCTGG + Intergenic
1063426315 10:5952866-5952888 GGGTCCAAGGCACGACAGGCAGG + Exonic
1071289576 10:84179143-84179165 TGCTCCAAGGCACAGCCAGTGGG - Intronic
1076649214 10:131976299-131976321 GACACCAAGTCACCACCACCGGG + Intronic
1076684685 10:132192803-132192825 GGCACCAAGGCAGCGCTAGCAGG + Exonic
1076774330 10:132686042-132686064 AGCTCCCAGTCACCACCATCAGG - Intronic
1077305797 11:1868227-1868249 GGCTACAAGGCACTCTCAGCCGG - Intronic
1077463827 11:2724066-2724088 GGCCCCCAGGCACCACCGGAGGG - Intronic
1077548236 11:3186249-3186271 GCTTCCGAGACACCACCAGCAGG + Intergenic
1078474964 11:11622158-11622180 AGCTCCCAGGCCCCACCTGCTGG + Intergenic
1083709712 11:64540627-64540649 GGCTCCAAGGCACCAGCACCAGG - Intergenic
1084536893 11:69762623-69762645 AGCTCCAAGCCATCAGCAGCTGG - Intergenic
1084537902 11:69768649-69768671 GCCTCCAAGGCTCCAGGAGCTGG + Intergenic
1086306069 11:85482592-85482614 GCCTCTAAGGCAATACCAGCAGG + Intronic
1089309281 11:117547239-117547261 AGCTACAAAGCACCCCCAGCGGG - Intronic
1091730949 12:2879817-2879839 AGCTCCAAAGCACAACCAGAGGG + Intronic
1091999046 12:5018056-5018078 CGCTCAAACCCACCACCAGCTGG + Intergenic
1094074429 12:26457299-26457321 GACTCCAAGGCACAGCCAGGAGG + Intronic
1096148112 12:49293231-49293253 GGCTCCAGGCCAACAGCAGCTGG + Intronic
1096427947 12:51520222-51520244 AGCTCTAAGGCACCATCAGATGG + Intergenic
1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG + Intronic
1096670523 12:53195817-53195839 GCCTCCAGGGCTCCTCCAGCTGG - Intronic
1100392122 12:94152680-94152702 GGCTGCAAGGCACAAGCGGCTGG + Intronic
1104674730 12:130704789-130704811 GGCTCCGGGGCTCCACCACCAGG + Intronic
1106179975 13:27362164-27362186 GGCCCCAAGGCATGACCCGCTGG + Intergenic
1109685409 13:65813131-65813153 GGGTCCCAGGCACCCCCACCTGG + Intergenic
1112468750 13:99668908-99668930 GGCTCCAGGGCAGGACAAGCTGG + Intronic
1112716497 13:102192065-102192087 GTCTCCAAGGCCCCACCCCCAGG + Intronic
1113696397 13:112349106-112349128 TCCTCGAAGGCACCTCCAGCAGG + Intergenic
1115257766 14:31420679-31420701 TGGTCCAAGGCCCCGCCAGCTGG + Intronic
1202865395 14_GL000225v1_random:114036-114058 GGCTCCCATGCACCTTCAGCAGG + Intergenic
1124637338 15:31373590-31373612 GGCTCCAGGCCACACCCAGCTGG + Exonic
1128719877 15:69940489-69940511 GGCTCCAAGGGGCCCCCAGAGGG - Intergenic
1129329818 15:74821243-74821265 GCATCCAAGGCTCCACCTGCGGG + Intronic
1132178329 15:99733092-99733114 GGCTCCACGGCTCCACGGGCGGG + Intronic
1132595190 16:745941-745963 GGCTCCGCAGCACCACCTGCCGG - Intronic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1133099373 16:3469993-3470015 GGCCCCAGGGCAGCCCCAGCAGG - Intronic
1136374285 16:29856210-29856232 GGCTCCTAGGCCGCCCCAGCTGG + Intergenic
1137290712 16:47050279-47050301 CTCTGGAAGGCACCACCAGCTGG + Intergenic
1137673938 16:50294579-50294601 GGCTCCTAGACAGCAGCAGCAGG - Intronic
1138064185 16:53923597-53923619 GGCGCCAAGGCCCAAGCAGCTGG + Intronic
1138300896 16:55929096-55929118 GGCTCTAAGACTCCACAAGCTGG + Intronic
1140901086 16:79368607-79368629 GCCTCCAAGTCCCCACCAGTAGG + Intergenic
1142059584 16:88020766-88020788 GTCTCCAAGGCAGAGCCAGCCGG - Intronic
1142589687 17:997259-997281 GGCTCCCAGGCTCCAGGAGCCGG - Exonic
1143010687 17:3864793-3864815 GGGTGCAAGCCACCTCCAGCAGG + Intronic
1145829910 17:27907553-27907575 GGCTCCAGTGCATCACCAGAAGG + Intergenic
1146057465 17:29588663-29588685 TGTTCCCAGTCACCACCAGCAGG + Intronic
1147963113 17:44179719-44179741 GGCTCGAAGGCACCGCGGGCTGG + Intergenic
1148693494 17:49545954-49545976 GCCTCCATGGCAGCAGCAGCTGG - Intergenic
1151814715 17:76466158-76466180 GGCTCCATGGCACCCCCTGGTGG - Exonic
1158366980 18:56747466-56747488 GGCCCCAAGCTACAACCAGCTGG + Intronic
1160750154 19:730169-730191 GGCTCCCAGACACCTCCTGCAGG + Intronic
1160832017 19:1108564-1108586 GGCCGCAAGGCAGCGCCAGCGGG + Exonic
1160975054 19:1789119-1789141 GGCTGCAGGGCACAAGCAGCTGG + Exonic
1160989141 19:1853485-1853507 GGCTCCACGGCCCCACCTGCAGG + Exonic
1161699825 19:5788442-5788464 GGCTCCAGGGCCTCAGCAGCTGG - Intronic
1162625490 19:11881376-11881398 GGGTGCAAGGAACCTCCAGCAGG + Intronic
1162902422 19:13803184-13803206 GGCTCCTTGCCACCTCCAGCTGG + Intronic
1164570445 19:29371016-29371038 GGCCCCATGGAGCCACCAGCAGG + Intergenic
1168192886 19:54752611-54752633 AGCTCCAATGTACCAGCAGCTGG + Exonic
926393180 2:12414844-12414866 GCCCCCAAAGCAACACCAGCCGG - Intergenic
926814682 2:16788593-16788615 ACCTGCAAGGCACCACCAGCAGG - Intergenic
927704245 2:25287226-25287248 TTCTAGAAGGCACCACCAGCAGG + Intronic
935719363 2:105966674-105966696 GCCTCCAAGGCAACACCAGAAGG - Intergenic
944977328 2:205069761-205069783 GGCTCCCTGGCACCAGCAGCAGG + Intronic
947202473 2:227626915-227626937 GGAACCAAGCCACCACCAGGAGG + Intronic
947629143 2:231640619-231640641 GCCTCCAAGACAGAACCAGCTGG - Intergenic
948328677 2:237148247-237148269 TGCTCCTTGGGACCACCAGCGGG - Intergenic
948399441 2:237673213-237673235 GGCTCTAAGTCACCACCAGGCGG + Intronic
948482602 2:238259641-238259663 GGCTCCCAGGCACACCCTGCTGG + Intronic
1168765791 20:381101-381123 GCCTCCAGGGCACCAGCAGGTGG - Exonic
1169257941 20:4112829-4112851 GGCTCCAAGGCAGCAGCTTCAGG - Intergenic
1169390919 20:5190282-5190304 GTCTCCAAGGCAAGCCCAGCTGG + Exonic
1172836089 20:37874051-37874073 GGCTGCAAGTGAGCACCAGCAGG - Intergenic
1174416304 20:50369563-50369585 GGCTGCAAGGCCCCACCCGGTGG + Intergenic
1175591958 20:60200437-60200459 GTCTCCACGGCACCAGCAGAGGG + Intergenic
1175785232 20:61708047-61708069 GGGTCCAGGGCACAGCCAGCTGG - Intronic
1175912605 20:62411995-62412017 GGCTCAATGGCAGCTCCAGCTGG - Intronic
1176377393 21:6093356-6093378 GCCTCCAAGGACCCAACAGCAGG + Intergenic
1179746081 21:43444888-43444910 GCCTCCAAGGACCCAACAGCAGG - Intergenic
1179786311 21:43732162-43732184 CCCTCCCAGGCACCACCAGGAGG - Intronic
1179786974 21:43735611-43735633 GGCTCCCAGGAACCACAGGCTGG - Intronic
1181510473 22:23386621-23386643 GGCTCCAAGGCCCCAGGAGGTGG - Intergenic
1182417139 22:30228836-30228858 GGCTCCATGGCAACACCACTAGG - Intergenic
1183069746 22:35387779-35387801 GGCCCCATGGCACCTCCAGGGGG - Intronic
1183495871 22:38143515-38143537 GGCCCCAGGGCCACACCAGCAGG + Intronic
1184045828 22:41971695-41971717 GGCTCCAAGGCCCAGCCGGCTGG - Intergenic
1184690226 22:46114131-46114153 GGCTCAAAGGCAGCACGAGAGGG - Intergenic
1184915542 22:47566320-47566342 GGCTCTGGGGCACCACCAGATGG - Intergenic
950028260 3:9835123-9835145 GGCAACAAGGCACTTCCAGCTGG - Exonic
954212950 3:49108584-49108606 GGCTCCAAGCCAGCACCCCCGGG - Intronic
954608923 3:51934045-51934067 GTCTCCAGGGCCCCACCACCAGG - Intronic
961501337 3:127338096-127338118 GGCTCCGGGGCCCCTCCAGCGGG - Intergenic
962236583 3:133712208-133712230 GGCTCCAGGGCACCACCATGAGG - Intergenic
963786544 3:149540317-149540339 GGTTCAAAGGCACCTACAGCTGG + Intronic
963880273 3:150520614-150520636 AGCTCCAGGGGACCAGCAGCTGG + Intergenic
967237673 3:187402838-187402860 GGCTTCAAGTTACCACCAGTGGG - Intergenic
968566002 4:1313179-1313201 AGCTGGAAGGCACCACCAGCCGG - Intronic
969423781 4:7112027-7112049 GGCTTCATAGCACCTCCAGCAGG + Intergenic
973296586 4:48529774-48529796 GGCACCAAGGCACCAAGAGTGGG + Intronic
976387615 4:84479874-84479896 GGCTGCAGGGCACCACCCACTGG + Intergenic
981026562 4:140082689-140082711 GGCACCAACGCACCCCCACCAGG + Intronic
981443222 4:144806698-144806720 GGCTCCCAGGCAGCACATGCTGG - Intergenic
985273704 4:188218383-188218405 GGCTCCAAGCAACCTCCATCTGG + Intergenic
985541810 5:490893-490915 GGCGCCAAGGAACCACGTGCTGG + Intronic
985718044 5:1473643-1473665 GTCTCCAAGGGACCCCCTGCAGG - Intronic
989346903 5:40439298-40439320 TTCTCCAAGGCCCCACCAGAGGG - Intergenic
990531848 5:56682013-56682035 AGCGCGAAGGCACCACCATCAGG + Intergenic
990989656 5:61672739-61672761 GGTTCCAAGGCACATCCTGCAGG - Intronic
995536637 5:113143217-113143239 GTCTGCAAGGCACCACCATCAGG - Exonic
996287799 5:121815367-121815389 GGGTCCTAGGAGCCACCAGCTGG - Intergenic
997735469 5:136209568-136209590 GTCTCCCAGGCACAGCCAGCAGG - Intergenic
1001053200 5:168428884-168428906 GGGTGGAAGGCAGCACCAGCAGG + Intronic
1004395602 6:15244971-15244993 GGCTGCACGGCACAAGCAGCAGG + Intergenic
1007655037 6:43446631-43446653 GTCCCCAAGCCACCACCACCTGG - Intronic
1007791397 6:44311016-44311038 GGTTCCAAAGCTCTACCAGCTGG + Exonic
1009306926 6:62102672-62102694 GGCTGCCAGGCACCAGCAGAGGG + Intronic
1014740454 6:125143142-125143164 GGGTCACAGGCACCCCCAGCTGG - Intronic
1014898101 6:126928614-126928636 GATTCCCAGGCACCACCAGTGGG - Intergenic
1017754707 6:157519628-157519650 GGCTCCAAGGCTCTGCCTGCTGG - Intronic
1018915464 6:168130030-168130052 CTCGCCCAGGCACCACCAGCAGG + Intergenic
1019916603 7:4137026-4137048 GACTCCAAAGCACGACCATCTGG - Intronic
1020101468 7:5396640-5396662 GGCAGCAAAGCACCTCCAGCTGG + Intronic
1020272464 7:6605542-6605564 GTCTCCAGGGCAGGACCAGCAGG - Intronic
1023247648 7:38222676-38222698 TGCTCCAAGGTACCACTAGGTGG - Intronic
1023483846 7:40663659-40663681 GGATCTAAGGGACAACCAGCAGG - Intronic
1026128013 7:67596636-67596658 AGCTCCAGCGCACCACCAGGAGG - Intergenic
1031974142 7:128083268-128083290 TGCTCCAAGGCAACAGAAGCAGG - Intronic
1035155553 7:156909231-156909253 GGCTCCAAGGCCCCAGGAGCAGG - Intergenic
1036184591 8:6612758-6612780 TTCTCAGAGGCACCACCAGCTGG - Intronic
1038404454 8:27311228-27311250 CGCTCCATGGCACGAGCAGCCGG + Exonic
1044858349 8:96497644-96497666 GACTCCAAGCCACCTCTAGCTGG - Intronic
1044995639 8:97835694-97835716 GGCTCCAAGGCACCACCAGCAGG - Intronic
1045318387 8:101062972-101062994 TGCTCCAAGTCCCCACCAGCAGG + Intergenic
1047917918 8:129603058-129603080 TGCTCCAAGGCTGCACGAGCAGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049402630 8:142436373-142436395 TGCTGCAAGGCAGCACTAGCTGG - Intergenic
1049651906 8:143773694-143773716 GGCTCCCAGGCAGCACCTACAGG - Intergenic
1057212609 9:93208940-93208962 GTCACCAAGGCACCATCAGAGGG - Intronic
1057266183 9:93619588-93619610 GGCCACCAGGAACCACCAGCAGG - Intronic
1057276858 9:93680709-93680731 GGGTCCCAGGCACCACCTGGGGG - Intergenic
1060545736 9:124458074-124458096 GGCACCAAGGCACCACCCGGTGG - Intronic
1061364851 9:130167176-130167198 GGCTCCTGGACACCACCAGGGGG + Intergenic
1061662855 9:132141769-132141791 AGCTCCACGGCAGCTCCAGCTGG + Intergenic
1062303827 9:135890647-135890669 GGCTCTGAGGCACCTCCACCAGG + Intronic
1062501647 9:136854407-136854429 GGATCCAAGGCACCCCCTCCTGG - Intronic
1203738948 Un_GL000216v2:162128-162150 GGCTCCCATGCACCTTCAGCAGG - Intergenic
1192073699 X:67967882-67967904 GGCTCCAATGCAACAGTAGCTGG + Intergenic
1198441920 X:136671789-136671811 CCCTCCAAGGCAGCTCCAGCTGG - Intronic