ID: 1044996310

View in Genome Browser
Species Human (GRCh38)
Location 8:97841097-97841119
Sequence TCCCAGATGGGGCAGCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8588
Summary {0: 6, 1: 34, 2: 291, 3: 1900, 4: 6357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044996299_1044996310 23 Left 1044996299 8:97841051-97841073 CCTCACTTCCCAGACAGTGGGGA 0: 1
1: 30
2: 80
3: 562
4: 4461
Right 1044996310 8:97841097-97841119 TCCCAGATGGGGCAGCAGCCGGG 0: 6
1: 34
2: 291
3: 1900
4: 6357
1044996302_1044996310 15 Left 1044996302 8:97841059-97841081 CCCAGACAGTGGGGAGCTGGGTA 0: 1
1: 1
2: 14
3: 40
4: 224
Right 1044996310 8:97841097-97841119 TCCCAGATGGGGCAGCAGCCGGG 0: 6
1: 34
2: 291
3: 1900
4: 6357
1044996303_1044996310 14 Left 1044996303 8:97841060-97841082 CCAGACAGTGGGGAGCTGGGTAG 0: 1
1: 1
2: 16
3: 40
4: 222
Right 1044996310 8:97841097-97841119 TCCCAGATGGGGCAGCAGCCGGG 0: 6
1: 34
2: 291
3: 1900
4: 6357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044996310 Original CRISPR TCCCAGATGGGGCAGCAGCC GGG Intronic
Too many off-targets to display for this crispr