ID: 1044998658

View in Genome Browser
Species Human (GRCh38)
Location 8:97861073-97861095
Sequence CTTGATGCCCAGCTCATACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044998658_1044998660 23 Left 1044998658 8:97861073-97861095 CCAGGTATGAGCTGGGCATCAAG No data
Right 1044998660 8:97861119-97861141 CAATAAAATTACATAAGTAATGG No data
1044998658_1044998659 -3 Left 1044998658 8:97861073-97861095 CCAGGTATGAGCTGGGCATCAAG No data
Right 1044998659 8:97861093-97861115 AAGACACATTGCAAACTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044998658 Original CRISPR CTTGATGCCCAGCTCATACC TGG (reversed) Intergenic
No off target data available for this crispr