ID: 1044998659

View in Genome Browser
Species Human (GRCh38)
Location 8:97861093-97861115
Sequence AAGACACATTGCAAACTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044998654_1044998659 20 Left 1044998654 8:97861050-97861072 CCTTAAACATCTTAATACAAAAT No data
Right 1044998659 8:97861093-97861115 AAGACACATTGCAAACTCATAGG No data
1044998658_1044998659 -3 Left 1044998658 8:97861073-97861095 CCAGGTATGAGCTGGGCATCAAG No data
Right 1044998659 8:97861093-97861115 AAGACACATTGCAAACTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044998659 Original CRISPR AAGACACATTGCAAACTCAT AGG Intergenic
No off target data available for this crispr