ID: 1044998660

View in Genome Browser
Species Human (GRCh38)
Location 8:97861119-97861141
Sequence CAATAAAATTACATAAGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044998658_1044998660 23 Left 1044998658 8:97861073-97861095 CCAGGTATGAGCTGGGCATCAAG No data
Right 1044998660 8:97861119-97861141 CAATAAAATTACATAAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044998660 Original CRISPR CAATAAAATTACATAAGTAA TGG Intergenic
No off target data available for this crispr