ID: 1044999682

View in Genome Browser
Species Human (GRCh38)
Location 8:97868976-97868998
Sequence AGGGGTGTCCTCTTTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044999682_1044999695 12 Left 1044999682 8:97868976-97868998 CCATCCCCAAAGAGGACACCCCT 0: 1
1: 0
2: 0
3: 23
4: 241
Right 1044999695 8:97869011-97869033 CCCGCTCCCCACCCCCGCCGCGG 0: 1
1: 0
2: 9
3: 89
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044999682 Original CRISPR AGGGGTGTCCTCTTTGGGGA TGG (reversed) Intronic
901007364 1:6178617-6178639 AGGGGAGTCCTCTCTTGGGGTGG - Intronic
901059593 1:6465890-6465912 AGGGGTTTCCTCTCAGTGGAAGG + Intronic
902409075 1:16202318-16202340 AGGGGTGCCCGCCATGGGGACGG + Intronic
902572390 1:17355088-17355110 AGGGAGGTCCTCTCTGGGGAAGG + Intronic
903025355 1:20426315-20426337 AGTGGTTTCCTCTCTGGGGTGGG + Intergenic
903181433 1:21606925-21606947 TGGGGTGTCTCCTTTGAGGAGGG - Intronic
904349554 1:29896032-29896054 AGGGTTGTCATGTTTGAGGAAGG + Intergenic
906717869 1:47983799-47983821 AGAAGTGTCCTTGTTGGGGACGG + Intronic
907282204 1:53357497-53357519 AGAGGTGTCCTATTTTGGAAAGG - Intergenic
908131670 1:61081514-61081536 AGGGATGTCCCCTTAGGGAAGGG - Intronic
909277759 1:73709739-73709761 AGGAAGGTCCTCTTGGGGGAAGG + Intergenic
910396848 1:86802321-86802343 TGGGGTGTCCTGTTTAGGGGGGG - Intergenic
910597351 1:88993515-88993537 ACTGGTGACTTCTTTGGGGAGGG + Intergenic
912426827 1:109601019-109601041 AGGGCTATCCTATTTGGAGATGG + Exonic
914510741 1:148329812-148329834 AGGGGTCTTCTCCTTGGGGCAGG - Intergenic
915027377 1:152843574-152843596 AGGGGTTTGATCTTTGGGGAGGG - Exonic
917280631 1:173375397-173375419 TGGGGTGTCCTGTTTAGAGAGGG + Intergenic
917808162 1:178632896-178632918 AGGGATATCCTTTTTGGGAATGG - Intergenic
917978932 1:180257473-180257495 ACGGGGGTCCTATTTGGAGAAGG - Intronic
918433108 1:184482684-184482706 AAGGGTGGCATATTTGGGGATGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920255457 1:204651495-204651517 TTGGGTGGCCTCTTTGAGGAAGG + Intronic
920756597 1:208739472-208739494 TGGGGTGTCCTCTTTAGAGGAGG + Intergenic
921260950 1:213384669-213384691 TGGGGTGGCCTCCTGGGGGAGGG - Intergenic
922241883 1:223760750-223760772 TGGGGTGTCCTCTTGGGGTAGGG - Intronic
922814412 1:228438761-228438783 AGGGGTGGCATCATTTGGGAAGG - Intergenic
923547492 1:234933349-234933371 AGGAGTGTCCCCTGTGGGTATGG - Intergenic
924945305 1:248842539-248842561 AGGGGTGGCCTCTCTGAGAAAGG + Intronic
1062948040 10:1475444-1475466 AGCGGCCTCCTCTGTGGGGAGGG + Intronic
1063364959 10:5485099-5485121 AGGGATGTCACCTTGGGGGATGG - Intergenic
1066293544 10:34035196-34035218 TGGGGTGTCCTGTTTGAGGGGGG + Intergenic
1067189680 10:44059029-44059051 AGGCATGTCTTCCTTGGGGATGG - Intergenic
1067762455 10:49058456-49058478 AGGGCTGTCCTCCCTGGGAAGGG + Intronic
1068746970 10:60543596-60543618 AGTGATTGCCTCTTTGGGGAGGG + Intronic
1070752883 10:78974192-78974214 AGGGGAGCCATCTCTGGGGAGGG - Intergenic
1073681745 10:105712312-105712334 AGGGCTGGCTTCTTTGGGGTTGG - Intergenic
1074107831 10:110401755-110401777 AGGGGTGTGCACCATGGGGAGGG - Intergenic
1074613391 10:115042109-115042131 TGGGGTGTCCTGTTTGGAGGGGG + Intergenic
1075146925 10:119890275-119890297 TGGGGTGTCCTCTTTAGAGGGGG + Intronic
1080639272 11:34149328-34149350 AGAGGTGTTTTCTTTGGAGACGG + Intergenic
1081669993 11:44937421-44937443 AGGGATGGCAGCTTTGGGGAAGG + Intronic
1083255113 11:61490864-61490886 AGGGGTGTTCCCCTGGGGGATGG - Exonic
1083626110 11:64072929-64072951 AGAGGGTTCCACTTTGGGGAAGG - Intronic
1085826964 11:79858116-79858138 AGGGCTGTGCACTTTGGGGGTGG + Intergenic
1086318017 11:85613440-85613462 TGGGGTGTCCTGTTTAGAGATGG + Intronic
1089623313 11:119735299-119735321 AGCTGGGTCCTCTTTGGGGTTGG - Intergenic
1089775610 11:120833427-120833449 AGAGGGGCCCTCTTTAGGGAAGG + Intronic
1091066583 11:132519240-132519262 AGGGTTTTCCACCTTGGGGAGGG + Intronic
1092078641 12:5694381-5694403 ACATGGGTCCTCTTTGGGGAAGG + Intronic
1092496995 12:9006302-9006324 AAGGAAGGCCTCTTTGGGGAGGG + Intronic
1095369099 12:41444450-41444472 AGGAGTGTTCCCTTTGTGGAAGG - Intronic
1097030100 12:56083670-56083692 AAGGGGGTGATCTTTGGGGATGG + Intronic
1097910987 12:64968996-64969018 GGGGGTGTCTGCTTTGGGGGAGG + Intergenic
1099576508 12:84390525-84390547 TGGGGTGTCCTGTTTGGAGGGGG - Intergenic
1100359072 12:93859661-93859683 TGGGTTGTCCTTTGTGGGGATGG + Intronic
1101533830 12:105599339-105599361 TGGGGTGCCCTCTATGAGGAAGG + Intergenic
1102600495 12:114026111-114026133 AGCAGTGTCCACTTTGGGAAGGG - Intergenic
1103215487 12:119198486-119198508 AGGGGTGTCTTCTTAGAGAAGGG + Intronic
1103489800 12:121308467-121308489 AGGGATGTCCTCTCTAGAGATGG + Exonic
1103932901 12:124460017-124460039 AGGGAAGGCCTCTGTGGGGAGGG - Intronic
1105505777 13:21008343-21008365 TGGGGTCTCCTCAGTGGGGAGGG + Intronic
1106024091 13:25940747-25940769 AGGCTAGTCCTCTGTGGGGAGGG - Intronic
1106977562 13:35238882-35238904 AGTGATATCCTCTTTGGTGAAGG - Intronic
1107104647 13:36630301-36630323 AGGGGTTTGCTCTCTGAGGAGGG + Intergenic
1108004459 13:45933245-45933267 AGGTTTGTTTTCTTTGGGGAAGG + Intergenic
1108682309 13:52790675-52790697 AGGGCCTTCCTTTTTGGGGAAGG - Intergenic
1114910101 14:27181601-27181623 AGGGGTGTGTTCTGTGAGGAAGG - Intergenic
1115796149 14:36937752-36937774 TGCTGTGTCCTCTGTGGGGATGG - Intronic
1116716267 14:48430864-48430886 AGGGGTGTCCTTCGTGGGAAGGG + Intergenic
1120071884 14:80112856-80112878 ATGGGTGTCCTCATTGGAGGGGG + Intergenic
1120835010 14:89031307-89031329 AGGGGGGTCCTCTTAGCAGAGGG + Intergenic
1122772822 14:104104843-104104865 GGGTGTGTCCTGTTTGGGAAGGG + Intronic
1122938936 14:104972683-104972705 ATGGCTGTCCGCGTTGGGGAGGG - Intronic
1127535997 15:59890380-59890402 ATGGGTGTCCTTCTAGGGGAGGG + Intergenic
1127998792 15:64171831-64171853 AAGGGACTCCTCTTTGGGGGAGG - Exonic
1132034276 15:98467968-98467990 AGGTGTGTCCTATTTTGGGATGG - Intronic
1132899628 16:2246181-2246203 AGGCGTGTCATCTGTGGGAACGG - Intronic
1133915427 16:10105253-10105275 AGGATTTTCCTCTTTGGGGGTGG - Intronic
1134125167 16:11611518-11611540 AGGGATGTCCTCTAGGGGAAAGG - Intronic
1135339000 16:21630377-21630399 AGGGGCCTCCTCTCTGGGGCTGG - Intronic
1136776092 16:32872675-32872697 ATGGGTGCCCTCTTTGAGGCTGG - Intergenic
1136894523 16:33988837-33988859 ATGGGTGCCCTCTTTGAGGCTGG + Intergenic
1137403899 16:48175397-48175419 AGGGAAGTCCTCCTTGGGCATGG - Exonic
1137671794 16:50283617-50283639 AGGGGACTCCCCTGTGGGGAAGG - Intronic
1140263196 16:73398270-73398292 AGATGTGTCCTCTTAGGGAAAGG + Intergenic
1141300739 16:82813252-82813274 AAGGGTGTCATCCTTGGGGAAGG + Intronic
1141795647 16:86271870-86271892 AGCTGTGTCCTCTTGGGGCAAGG - Intergenic
1203078508 16_KI270728v1_random:1134784-1134806 ATGGGTGCCCTCTTTGAGGCTGG - Intergenic
1143103589 17:4517225-4517247 AGAGGGGGCCTCTATGGGGAAGG - Intronic
1145278662 17:21453105-21453127 CGGGGTGTGCTCTTGGGGTAGGG + Intergenic
1146311425 17:31771309-31771331 TGGGGTGTCCTGTTTAGAGAGGG + Intergenic
1148231010 17:45935051-45935073 AGGGTAGCCCTCTCTGGGGAGGG + Intronic
1148354731 17:46968278-46968300 AGGGGTGTCCACAGTGCGGAGGG - Intronic
1148379366 17:47182454-47182476 GGTGGTTTCCTCTTTGGGGCAGG - Intronic
1149867776 17:60160238-60160260 AAGGGTGTCATGTGTGGGGATGG + Intronic
1150625867 17:66840736-66840758 GGGGATGTCTTCCTTGGGGATGG + Intronic
1155060390 18:22223301-22223323 AAGGCTGTCCTGGTTGGGGAGGG + Intergenic
1155288830 18:24320420-24320442 AGGGAAGGCCTCTTTGAGGAAGG + Intronic
1157536319 18:48460708-48460730 AGGTGTCACATCTTTGGGGAAGG - Intergenic
1157551924 18:48588194-48588216 GGGGGTGTCCTCTGTGGGAGAGG - Intronic
1161482789 19:4519188-4519210 GGGGGTGTCCTCAGTGTGGAGGG + Intergenic
1163366067 19:16876772-16876794 AGTGGTCTGCTCTTTGGAGAGGG - Intronic
1164264212 19:23597324-23597346 AGGCATGTCCTCTTGTGGGAAGG - Intronic
1165246451 19:34500806-34500828 AGGGGTGACACCCTTGGGGAGGG + Exonic
1165761733 19:38325720-38325742 AGGGGAGCATTCTTTGGGGAAGG + Intronic
1166268920 19:41701656-41701678 AGGGGTCACGTCATTGGGGAAGG - Intronic
1167233121 19:48297656-48297678 CGGGGGGTCTTCTCTGGGGAGGG + Exonic
1168318282 19:55493762-55493784 GGGGGCGCCTTCTTTGGGGAGGG + Exonic
925201416 2:1970118-1970140 AGCGCTGTTCTCTTTGGGGCAGG + Intronic
925657401 2:6164769-6164791 GGGGGTGTCCTCTGTGGAGCAGG - Intergenic
926056250 2:9775802-9775824 AGGGGTGTCAGCTTTGGGTGAGG + Intergenic
926089048 2:10038192-10038214 AGGTGTGTCCAGTGTGGGGAGGG + Intergenic
928899810 2:36304831-36304853 AGGGTTGGCATCTTTTGGGAGGG - Intergenic
929362009 2:41103130-41103152 AGGGGTGTCAACTTGGGGGAAGG - Intergenic
929544238 2:42845376-42845398 AGGGGCCTTCTCTTTGGGGCAGG + Intergenic
929686884 2:44043125-44043147 AGGTGTGGCCACTTTGGGGAGGG - Intergenic
931036572 2:58250934-58250956 TGGGTTGTCCACTTTGGGAAGGG + Intergenic
931246662 2:60498057-60498079 AGGGGTCTTCTCTTTGGGGGAGG + Intronic
931540921 2:63328028-63328050 TGGGGTGTCCTGTTTAGAGAGGG + Intronic
932320130 2:70815960-70815982 AGGGGAGTCGCGTTTGGGGAGGG - Intronic
932797548 2:74710402-74710424 ATAGTTGTCCTATTTGGGGAAGG - Intergenic
933744543 2:85561264-85561286 GGGGGGGTCCTCTGTGGGGAAGG - Intronic
934478029 2:94605788-94605810 GGGGGTGTCCTTTTTGGGGCTGG + Intergenic
935248022 2:101236192-101236214 TGGGGTGTCCTGTTTAGAGAGGG + Intronic
935666792 2:105519103-105519125 AAGTGTGACCTCTCTGGGGAAGG + Intergenic
937340359 2:121087143-121087165 AGAGGTGACCTCTTGGGGGTGGG - Intergenic
937863825 2:126733166-126733188 AGGGGACTCCTGCTTGGGGAGGG + Intergenic
938071884 2:128312682-128312704 AAGGGTGTACTCATTGGGCAAGG + Intronic
938093196 2:128446633-128446655 AGGGCTGTCCCCTTCTGGGAAGG + Intergenic
938794715 2:134707743-134707765 TGGTGAGGCCTCTTTGGGGAGGG + Intronic
941377720 2:164751792-164751814 ATGGTTTTCCTATTTGGGGAAGG + Intronic
944449798 2:199830523-199830545 AGCTTTGTACTCTTTGGGGATGG - Intronic
945739942 2:213647085-213647107 AGGGTTGTTCTCTTGGGAGAGGG + Intronic
945888600 2:215404524-215404546 TGGGCTGTCCTCTTCGGGTAAGG + Exonic
947698752 2:232215325-232215347 AGGGCTGCACTCTGTGGGGATGG - Intronic
947797128 2:232901684-232901706 GGGGGTGACCTGTGTGGGGAGGG - Intronic
948611860 2:239174961-239174983 AGAGGAGTTATCTTTGGGGAAGG + Intronic
1169416846 20:5424461-5424483 AGGGGTTTTCTCTCTGGAGAAGG + Intergenic
1171261972 20:23742079-23742101 TGGGGTGTCCTGTTTGAGGAGGG + Intergenic
1171412501 20:24956668-24956690 AGGGGTGCCCTCCTGGGGGCTGG + Intronic
1172093383 20:32448748-32448770 AGGGGTGTGCGTGTTGGGGAGGG + Intronic
1172164982 20:32893509-32893531 AGGGGTGGCCTCTCTGAGGATGG + Intronic
1175130851 20:56788550-56788572 AGGGAAGGCCTCTTTGGGGCAGG + Intergenic
1175235636 20:57508877-57508899 AGTGGACTCATCTTTGGGGAGGG - Intronic
1175874185 20:62221655-62221677 AGGAGTCTGCTCTTGGGGGAGGG + Intergenic
1177084902 21:16691624-16691646 AGGGGAGGCCTCTCTGTGGAGGG - Intergenic
1178601494 21:33998699-33998721 AACTGTGTCCTCTGTGGGGATGG + Intergenic
1179451909 21:41473639-41473661 GGGGGTCTCCTCTTGGGGAAGGG + Intronic
1179613245 21:42565701-42565723 AGGGGTTTCCACTCTTGGGATGG + Intronic
1179792331 21:43762828-43762850 GAGGGGGTCCTCATTGGGGAGGG - Intergenic
1180841340 22:18960267-18960289 GGGGGTTTCCTCTATGGGGCAGG - Intergenic
1181060158 22:20278527-20278549 GGGGGTTTCCTCTATGGGGCAGG + Intronic
1181772922 22:25139752-25139774 AGGGAAGCCCTCTTTGAGGAGGG + Intronic
1182656875 22:31897698-31897720 AGTGGTGTCCTTGTTAGGGACGG - Intronic
1183345319 22:37304242-37304264 AGGCGTGTCCTGATTGGGAAAGG + Intronic
1184606736 22:45578691-45578713 AGGGCTGGCCCCTTTGGGGCGGG - Intronic
1184968068 22:47995940-47995962 AAGGCTGGCCCCTTTGGGGAAGG - Intergenic
1185026629 22:48417805-48417827 AGAGATGTCTTCTTTGGGGGAGG - Intergenic
1185233036 22:49694177-49694199 AGGGGTGTGCTCTGTGGGGTGGG - Intergenic
949922442 3:9013680-9013702 AGGCCTGGCCTCTTTTGGGAGGG - Intronic
951091512 3:18579104-18579126 AAATGTGTCCTCTTTTGGGAGGG + Intergenic
953755654 3:45643711-45643733 GGGGGTGCCCACCTTGGGGATGG + Intronic
956473286 3:69592383-69592405 AGTTTTGTCCTCTTTGGAGAAGG + Intergenic
961183596 3:124895631-124895653 TGGGGTGTCATGTTTGGGGCTGG + Intronic
962344531 3:134609712-134609734 AGGGCTGTGGTTTTTGGGGAAGG - Intronic
965829995 3:172775051-172775073 AATGCTGTCCTCTTTGGTGAAGG + Intronic
966047480 3:175570273-175570295 AGGGGTGTCCACATTGAGTAGGG + Intronic
966822766 3:183938040-183938062 AGGGAAGTCCTCGCTGGGGATGG - Exonic
968234363 3:197023011-197023033 AGGGGTGACAGCTCTGGGGAAGG - Exonic
969106750 4:4812120-4812142 AGGTTTTTCCTCTTTGGGAAGGG + Intergenic
970512379 4:16794070-16794092 AGTGCTGTCCCCTTTGGGCACGG - Intronic
972389974 4:38605199-38605221 AGGGGTGGTATCTCTGGGGAAGG - Intergenic
974891874 4:67893154-67893176 AGGAGTGCCCTCTGTGGGAATGG + Intergenic
974913995 4:68157132-68157154 TGGGGTTTCCTCTTTTGGGTTGG - Intergenic
977008973 4:91611639-91611661 AGTGGTGTCTTCTCTGGGTAAGG - Intergenic
977755312 4:100663662-100663684 TGGGATGTTCTCTTTGGTGAAGG + Intronic
978761216 4:112357726-112357748 GTGCTTGTCCTCTTTGGGGAAGG + Intronic
981952344 4:150423752-150423774 AGGGGCGTCCCCTAAGGGGACGG - Intronic
982609109 4:157551316-157551338 AGAGGTGTGCTCTTGGGGCAGGG + Intergenic
983627690 4:169818873-169818895 TGGGATGTCATCTCTGGGGAGGG - Intergenic
983915065 4:173282893-173282915 GGAGGTTTCCTTTTTGGGGAAGG - Intronic
985182344 4:187279197-187279219 AGGCGTCTCCCCTGTGGGGATGG - Intergenic
985892789 5:2728914-2728936 AGGTGTCTCCTCTGTGTGGAGGG + Intergenic
987962373 5:24827017-24827039 AGGGGTGGGCTGTTAGGGGAGGG - Intergenic
988709172 5:33756271-33756293 AGGGCTGTGTTCTGTGGGGAAGG - Intronic
994191687 5:96875886-96875908 AGAGGTTTCATCTTTGTGGAAGG + Intronic
997355231 5:133258368-133258390 AGGCCTGCCCTCATTGGGGAGGG - Intronic
997439799 5:133901166-133901188 ATGTGTTTCCTCTTTGAGGATGG + Intergenic
998572346 5:143273776-143273798 ATGGTTGCCCTCTCTGGGGATGG + Intergenic
998677157 5:144422522-144422544 AGGGCTGTACTATTTGGAGACGG - Intronic
999145297 5:149389088-149389110 AGGGTTGTTCTCTCTGGAGATGG - Intronic
999804253 5:155067290-155067312 AGGGGTATCCTTTTTGGGACTGG + Intergenic
1001985644 5:176072854-176072876 ACAGGTGTCCTCAATGGGGATGG + Intronic
1002231227 5:177765270-177765292 ACAGGTGTCCTCAATGGGGATGG - Intronic
1002264110 5:178018478-178018500 ACAGGTGTCCTCAATGGGGATGG + Intronic
1002593024 5:180304184-180304206 AGGGGTCTCTTCTTTTGGGTTGG + Intronic
1003542624 6:7031870-7031892 GTGGATGTCCTTTTTGGGGATGG + Intergenic
1005950478 6:30627548-30627570 AGGGAGGACCTCTGTGGGGATGG + Intronic
1006337477 6:33428084-33428106 AGGGGTGTCCCCGGTGGGGGAGG - Intronic
1006749261 6:36366449-36366471 AGGAGTGTCATCTTTTGGGCAGG - Exonic
1006844935 6:37055679-37055701 AGGGGTGCACAGTTTGGGGAGGG - Intergenic
1007803588 6:44419468-44419490 TGGGGTGTCCACATTGGTGAGGG - Exonic
1010720960 6:79282933-79282955 GGTGCTGTCCTCTTTAGGGAAGG + Intergenic
1012982858 6:105848149-105848171 AGTGGTGGCCTCCTTGAGGATGG - Intergenic
1016368013 6:143339791-143339813 AAAGGTGTCCTCATTGGGGGAGG - Exonic
1017039103 6:150293562-150293584 GGGAGTGTATTCTTTGGGGAAGG + Intergenic
1018300704 6:162399463-162399485 AGGGGTGTCCTGTATGTGGTGGG - Intronic
1018415763 6:163600960-163600982 AGGGCTGTCTGCTTTGGGAAGGG + Intergenic
1018696786 6:166396972-166396994 AGGTGGGGCCTTTTTGGGGAGGG + Intergenic
1019763328 7:2830477-2830499 AGGCATGTCCCCTGTGGGGAGGG + Intronic
1019984905 7:4648481-4648503 AGGGCTCTCCACTGTGGGGACGG + Intergenic
1021523608 7:21561737-21561759 AGGGTTGTCATCTTTGGGTGGGG - Intronic
1021831021 7:24609739-24609761 GGGTTTGTTCTCTTTGGGGAGGG - Intronic
1021988184 7:26117430-26117452 GAGGGTGTCCTTTTTGGGGATGG + Intergenic
1022639696 7:32170367-32170389 GGTGGTGCCCTCTTTGGGGTGGG - Intronic
1023246239 7:38207445-38207467 AGGTGTCTTCTCTTTAGGGATGG + Exonic
1023256878 7:38321249-38321271 AGGGGTTTCCTGTTTGGTGCTGG + Intergenic
1024094358 7:45972512-45972534 AGGGGTGTAGTCTTTGGGCTGGG + Intergenic
1026479905 7:70769305-70769327 ATGGGTTTCCTCTTTGGGTCTGG + Intronic
1026498553 7:70923708-70923730 AAGTGTGTCCTCGGTGGGGAGGG - Intergenic
1026975467 7:74495207-74495229 GGGCGTGTCCCCTTTGGGAAGGG + Intronic
1027879896 7:83821469-83821491 AGGTGTTTCCTCTTTGAAGAGGG - Intergenic
1029179534 7:98690124-98690146 AGGTGTGTGCTTTGTGGGGAAGG - Intergenic
1030699128 7:112619580-112619602 AGGGCTGTCCTTTTTTTGGAAGG - Intergenic
1031929296 7:127668323-127668345 TGGGGAGTCCTCTTTGAGGAAGG - Intronic
1034348073 7:150399095-150399117 AGGGGTGACCTCTTGGGGGCAGG - Intronic
1036797964 8:11769662-11769684 AGGGGCGTCCCCTAAGGGGACGG + Intronic
1037877315 8:22554440-22554462 CTGCGTGTCCTCTGTGGGGAAGG - Exonic
1038388391 8:27171651-27171673 AGGGATCTGGTCTTTGGGGATGG - Intergenic
1039996520 8:42539099-42539121 AGGCATTTTCTCTTTGGGGAGGG - Intronic
1040649826 8:49434982-49435004 TGGGGTGTCCTGTTTGGAGGGGG + Intergenic
1040999561 8:53437445-53437467 TGGGGTGTCCTGTTTAGAGAGGG - Intergenic
1041002820 8:53468421-53468443 TGGGGTGTCCTGTTTAGAGAGGG + Intergenic
1041501182 8:58540321-58540343 GGCAGTGTCCTCTTTGGGTAAGG + Intergenic
1041945076 8:63431888-63431910 AGAGGTATCCATTTTGGGGAAGG - Intergenic
1043296388 8:78668171-78668193 AGGTGTGATCTCTTAGGGGAGGG - Intronic
1044999682 8:97868976-97868998 AGGGGTGTCCTCTTTGGGGATGG - Intronic
1045257673 8:100542605-100542627 AGGGGTAACCTATTTTGGGAAGG + Intronic
1048449674 8:134522554-134522576 TGGAGTGTGCTCTTTGGAGAGGG - Intronic
1049125604 8:140784582-140784604 AGGTGTGGCCTCTGTGGGGAGGG - Intronic
1049201839 8:141344058-141344080 AGCGCTGTCCTCTGTGGGAAAGG + Intergenic
1049340708 8:142111120-142111142 GGGGGTGCTCTCTTTGGAGAAGG - Intergenic
1050150641 9:2616428-2616450 AGAGGTGCCCTCTTGAGGGATGG - Intergenic
1050564685 9:6869719-6869741 AGGGGTATGTTCTTGGGGGAGGG + Intronic
1052851919 9:33383772-33383794 GGGGGTGTCCTTTTTGGGGGTGG - Intergenic
1052857916 9:33418444-33418466 AGGGGTGTCAGCCATGGGGATGG - Intergenic
1053077408 9:35144498-35144520 AAGGGCATCCTCTTTGGAGAGGG - Intergenic
1053680027 9:40480320-40480342 GGGGGTGTCCTTTTTGGGGCTGG - Intergenic
1053930020 9:43108630-43108652 GGGGGTGTCCTTTTTGGGTCTGG - Intergenic
1054283685 9:63144615-63144637 GGGGGTGTCCTTTTTGGGGCTGG + Intergenic
1054293108 9:63315830-63315852 GGGGGTGTCCTTTTTGGGGCTGG - Intergenic
1054391134 9:64620323-64620345 GGGGGTGTCCTTTTTGGGGCTGG - Intergenic
1054504594 9:65896004-65896026 GGGGGTGTCCTTTTTGGGGCTGG + Intergenic
1056549318 9:87638585-87638607 AGGTGTGGTCTCTTTGGGAAGGG + Intronic
1059653239 9:116334582-116334604 AGGGGTGGCCATTTGGGGGAGGG + Intronic
1061074216 9:128331400-128331422 AGGGGTGGCCTCTCTGTGGTGGG + Intronic
1061986403 9:134132594-134132616 AGGGGTGGCCTCTTCAGAGACGG - Intergenic
1062002324 9:134222702-134222724 ATAGGTCTCCTTTTTGGGGATGG - Intergenic
1186225501 X:7395074-7395096 CAGCGTGTCCTCTTTGGGCAGGG + Intergenic
1188999774 X:36931385-36931407 AGGGAGGTCTGCTTTGGGGAAGG + Intergenic
1190263979 X:48816632-48816654 AGGTGTGTCCTCTGTGGGCTGGG + Exonic
1190760368 X:53433617-53433639 AAGGGTCTCCTCTATGGGGGCGG - Intronic
1194668187 X:96698605-96698627 AGGGGCTTTTTCTTTGGGGAAGG - Intronic
1196367783 X:114942904-114942926 AGAGTTCTCCTCTTTGGGCAAGG - Intergenic