ID: 1045001586

View in Genome Browser
Species Human (GRCh38)
Location 8:97883074-97883096
Sequence CAGGCAGATTGCCCGACGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045001578_1045001586 27 Left 1045001578 8:97883024-97883046 CCAGGTGCTGTGGCTCATGCTTG 0: 18
1: 974
2: 15051
3: 56254
4: 130333
Right 1045001586 8:97883074-97883096 CAGGCAGATTGCCCGACGTCAGG No data
1045001584_1045001586 -8 Left 1045001584 8:97883059-97883081 CCTGAGAGGCCAAGGCAGGCAGA 0: 1
1: 15
2: 74
3: 246
4: 940
Right 1045001586 8:97883074-97883096 CAGGCAGATTGCCCGACGTCAGG No data
1045001583_1045001586 -7 Left 1045001583 8:97883058-97883080 CCCTGAGAGGCCAAGGCAGGCAG 0: 6
1: 159
2: 478
3: 1449
4: 3015
Right 1045001586 8:97883074-97883096 CAGGCAGATTGCCCGACGTCAGG No data
1045001580_1045001586 0 Left 1045001580 8:97883051-97883073 CCTAGCACCCTGAGAGGCCAAGG 0: 6
1: 226
2: 7787
3: 105170
4: 229450
Right 1045001586 8:97883074-97883096 CAGGCAGATTGCCCGACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045001586 Original CRISPR CAGGCAGATTGCCCGACGTC AGG Intronic
No off target data available for this crispr