ID: 1045002216

View in Genome Browser
Species Human (GRCh38)
Location 8:97888263-97888285
Sequence CACCCCCACCTGCCCACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 286}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045002216_1045002225 1 Left 1045002216 8:97888263-97888285 CCAAAAGTGGGCAGGTGGGGGTG 0: 1
1: 0
2: 2
3: 35
4: 286
Right 1045002225 8:97888287-97888309 TTTGGGGAGGGCTCAGGGACAGG 0: 1
1: 0
2: 4
3: 45
4: 397
1045002216_1045002224 -4 Left 1045002216 8:97888263-97888285 CCAAAAGTGGGCAGGTGGGGGTG 0: 1
1: 0
2: 2
3: 35
4: 286
Right 1045002224 8:97888282-97888304 GGTGGTTTGGGGAGGGCTCAGGG 0: 1
1: 1
2: 2
3: 49
4: 452
1045002216_1045002223 -5 Left 1045002216 8:97888263-97888285 CCAAAAGTGGGCAGGTGGGGGTG 0: 1
1: 0
2: 2
3: 35
4: 286
Right 1045002223 8:97888281-97888303 GGGTGGTTTGGGGAGGGCTCAGG 0: 1
1: 0
2: 3
3: 70
4: 575
1045002216_1045002227 7 Left 1045002216 8:97888263-97888285 CCAAAAGTGGGCAGGTGGGGGTG 0: 1
1: 0
2: 2
3: 35
4: 286
Right 1045002227 8:97888293-97888315 GAGGGCTCAGGGACAGGGATTGG 0: 1
1: 0
2: 5
3: 60
4: 615
1045002216_1045002226 2 Left 1045002216 8:97888263-97888285 CCAAAAGTGGGCAGGTGGGGGTG 0: 1
1: 0
2: 2
3: 35
4: 286
Right 1045002226 8:97888288-97888310 TTGGGGAGGGCTCAGGGACAGGG 0: 1
1: 1
2: 2
3: 49
4: 645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045002216 Original CRISPR CACCCCCACCTGCCCACTTT TGG (reversed) Intronic
900175752 1:1290702-1290724 CACCCCCACCCCACCACTTTGGG - Intronic
900937490 1:5775686-5775708 CACCACCACCTGCTAAATTTTGG - Intergenic
901274963 1:7984019-7984041 CACCCCCACCTCCCCAAATTAGG - Intronic
901877264 1:12173991-12174013 CACTCCCCCCTGCACACTTGGGG - Intronic
902461851 1:16583562-16583584 CTCCCCCACCTGCCCCCATGGGG + Intronic
903068262 1:20713420-20713442 CAGCCCCACCTGCCCACAATGGG + Intronic
904205927 1:28855298-28855320 CGCTCCCACCTCCCCACTTCGGG - Intronic
904474236 1:30754646-30754668 CACCCAAACTTGCACACTTTGGG - Intronic
905283561 1:36864666-36864688 CACCCCAACCTGCCCCCTCCCGG - Intronic
905440869 1:37996119-37996141 CCCGCCCATCTCCCCACTTTGGG + Intergenic
905653767 1:39672851-39672873 GGCCCCCACCTGCCCAGCTTGGG + Intergenic
906086881 1:43143866-43143888 CCCTCCTACCTGCCCTCTTTTGG + Intergenic
906639603 1:47433727-47433749 GAAGCCCACCTGCCCACTTCAGG - Intergenic
910165756 1:84325809-84325831 CACTCCCTTCTGCCCACTGTTGG - Intronic
910297829 1:85669235-85669257 GAGCCCCACCTGACCTCTTTTGG - Intronic
913081376 1:115390461-115390483 GACTGCCACCTGGCCACTTTGGG + Intergenic
915902048 1:159854559-159854581 CGCCCGCCCCTTCCCACTTTTGG + Exonic
917283422 1:173400562-173400584 AACTGCCACCTGGCCACTTTGGG + Intergenic
918153328 1:181818098-181818120 CACCCTCACCTGCTCCCATTTGG - Intergenic
919766896 1:201133343-201133365 TACACCCACCTGCCCACCTTTGG + Intergenic
919814279 1:201427980-201428002 TACCCCCACCTGCCCAGTGCTGG - Intronic
920685033 1:208102767-208102789 CACCACCATCTGCACACTCTTGG + Intronic
921536177 1:216351273-216351295 AAACACCACCTCCCCACTTTGGG - Intronic
921937762 1:220810572-220810594 CACCCCGACCTGTGCAGTTTAGG + Intronic
923050883 1:230390609-230390631 CATCCCTACCTGCCCACTCCAGG + Intronic
924419858 1:243897893-243897915 CACCCACCCCTACCCACTTTTGG + Intergenic
924846634 1:247780823-247780845 CACACCAACCTCCCCCCTTTTGG + Intergenic
1062838429 10:651153-651175 CACCTCCACCTGCCCAGGTCTGG + Exonic
1063401671 10:5752166-5752188 CCCCCCCACCTGCACATGTTGGG - Intronic
1063944368 10:11162595-11162617 CACCCCCCCCACCCCAGTTTAGG - Intronic
1064037518 10:11926628-11926650 CATCCCCACCTGCCATCTCTTGG - Intronic
1064575095 10:16737007-16737029 CTCCCCCACCATCCCCCTTTTGG - Intronic
1064713886 10:18155168-18155190 CAGCCTCACCTGTCCCCTTTTGG + Intronic
1065385738 10:25131407-25131429 GACCCACCCCTCCCCACTTTTGG - Intergenic
1068876511 10:62002564-62002586 CCTCCCCACCGTCCCACTTTCGG + Intronic
1069071625 10:63995705-63995727 CACTCTCACCTGCTCACTTATGG - Intergenic
1069912274 10:71766845-71766867 CAGCCCCGCCTGCCCACTGGAGG - Intronic
1070298984 10:75189266-75189288 AACCCCTACCTGCCCACAGTGGG + Intergenic
1072483838 10:95835089-95835111 CCTCCCCACCTCCCCTCTTTTGG + Intronic
1072528298 10:96294481-96294503 CACCCCCACCCCCACCCTTTGGG + Intergenic
1072551092 10:96478199-96478221 CACTCCCATCTGCCAACCTTGGG + Intronic
1072809486 10:98447643-98447665 CACCCCTTCCAGCCCACCTTAGG + Intergenic
1073049430 10:100657893-100657915 CACCCCCACCTCCCCAGCTTAGG - Intergenic
1073658613 10:105446903-105446925 CTTCCCCACCTCCCCTCTTTTGG + Intergenic
1073830317 10:107376365-107376387 GACTGCCACCTGGCCACTTTGGG - Intergenic
1074235453 10:111580456-111580478 AACTTCCACCTGGCCACTTTGGG - Intergenic
1074242341 10:111651691-111651713 TACCACCACCTACCCACTCTAGG - Intergenic
1074755632 10:116622097-116622119 CAACCCCGCCAGCCCACTCTTGG + Intronic
1075855062 10:125622855-125622877 CACTGCCACCTGGCCACTCTGGG - Intronic
1076054350 10:127359179-127359201 CACCCACTCCTGCTCACCTTGGG + Intronic
1076307080 10:129473001-129473023 GAAGCCCACCTGCCCACTCTAGG - Intronic
1076708821 10:132319720-132319742 CATCCCCACACTCCCACTTTAGG - Intronic
1076883255 10:133249639-133249661 CAGCCCCCCGTGCCCACTCTGGG - Intergenic
1078731006 11:13974006-13974028 CATCCTCACCTGCTCACTTTTGG + Intronic
1080277658 11:30521320-30521342 CATCCCCACCAGCCCCATTTAGG + Intronic
1081431254 11:42979017-42979039 GTCTCCCACCTTCCCACTTTGGG + Intergenic
1081582706 11:44363421-44363443 CACCCCCATCTTCCCAAATTAGG + Intergenic
1083420115 11:62547556-62547578 CGCCCCCGCCTCCCCACTTGCGG + Intronic
1083448804 11:62728560-62728582 CACCCCCACATCGCCTCTTTAGG + Exonic
1083653799 11:64219543-64219565 CTCCCCCACCTCCCCGCTCTGGG - Exonic
1084218513 11:67664387-67664409 CACCCCCACCTGGCTGCTGTTGG + Exonic
1084269796 11:68022748-68022770 CACCCCCACCTGGCTGCTGTTGG - Exonic
1085013494 11:73157589-73157611 CACCCCCGCCTGCCCACCCCGGG + Intergenic
1085294362 11:75422649-75422671 GACCTCCACCTGCCCACTGCTGG + Exonic
1086516024 11:87614228-87614250 CAGCCACACCTGCCTTCTTTTGG + Intergenic
1088047331 11:105470130-105470152 CACTCCCACCTGCCCTCTACTGG - Intergenic
1089766764 11:120773531-120773553 CACCCCCACTTCCCCACTCCAGG - Intronic
1090197041 11:124825688-124825710 GACTGCCACCTGGCCACTTTGGG - Intergenic
1090363302 11:126187727-126187749 CTCCCCCACCTGCCCAAGGTGGG - Intergenic
1090432149 11:126655061-126655083 CACCACCACCTGCCCACAGTGGG - Intronic
1090722575 11:129489942-129489964 CAGCCCATCATGCCCACTTTTGG - Intergenic
1090753798 11:129770957-129770979 GACTTCCACCTGGCCACTTTGGG - Intergenic
1090954024 11:131498761-131498783 CACCCCCTCCTGGCAGCTTTGGG - Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096488956 12:52003269-52003291 CCCCCCCACCTCCCCAGCTTAGG + Intergenic
1096526410 12:52212763-52212785 CTCCCCCACCTGCCCTCCTGGGG + Intergenic
1096773363 12:53950206-53950228 CACCCCCACCTGCCTCCTGGTGG + Intergenic
1099476956 12:83119951-83119973 TAGCCCCTCCTGCTCACTTTTGG + Intronic
1100633654 12:96413481-96413503 CACCCCCCCATCCCCAATTTTGG - Intergenic
1104433095 12:128732686-128732708 CACCCCCAACTGCCTGCTCTAGG + Intergenic
1104976206 12:132553089-132553111 CACCCACCCCAGCCCACTTCTGG + Intronic
1107980475 13:45729964-45729986 CAGCCCCACCTGCCTACATTGGG - Intergenic
1109069652 13:57748231-57748253 GACTGCCACCTGGCCACTTTGGG + Intergenic
1113810278 13:113137340-113137362 CTCCCCCACCTGCCAACCCTTGG - Intronic
1114260154 14:21030763-21030785 CACCCCCACCTCCATATTTTTGG - Intronic
1115493445 14:33980894-33980916 CACCCCCACTACCCCACTATAGG + Intronic
1117076502 14:52110285-52110307 CACCCACACCTGGCTAATTTTGG + Intergenic
1118528693 14:66676147-66676169 AACCCCAACCTCCCCTCTTTTGG + Intronic
1118780828 14:69006480-69006502 CACCCCCACCTCCCCAGTTCGGG + Intergenic
1118965405 14:70578834-70578856 CCCCCCTCCCTCCCCACTTTTGG + Intergenic
1120124824 14:80729039-80729061 CACCCCCACCAGCCCAGCCTGGG - Intronic
1122098991 14:99392445-99392467 CACCCCAACCAGCCTAGTTTTGG - Intergenic
1122115496 14:99525421-99525443 CACCCCAGCCTGCCCACCTGAGG + Intronic
1122736547 14:103847123-103847145 CGCCCCCACCTGCCCGCCTGGGG + Intronic
1122866267 14:104605317-104605339 CACCCCCTCCTGCCCACACCTGG - Intronic
1122885654 14:104709214-104709236 CACCCCCACCCAGCCTCTTTGGG - Intronic
1123073285 14:105652517-105652539 CAGCCCCTCCTGCCCTCTTCTGG + Intergenic
1123439444 15:20280288-20280310 CAGACCCTTCTGCCCACTTTGGG - Intergenic
1123995689 15:25716405-25716427 CACACCCACCTGCCTACCTGAGG + Intronic
1125380239 15:39079525-39079547 CACCCTCATCTGCCTGCTTTAGG - Intergenic
1125689310 15:41583787-41583809 TACCCCTACCTTCCCACTCTGGG - Intergenic
1125752991 15:42043096-42043118 CACCCCCGCTTGCCCAGTGTAGG - Intronic
1126197884 15:45952218-45952240 GAGCCCCAGCTGCCCCCTTTAGG + Intergenic
1127023274 15:54775217-54775239 CACCCCCAGTAACCCACTTTGGG + Intergenic
1127615509 15:60681597-60681619 TACCCACACTTGCCCACCTTAGG + Intronic
1128235805 15:66066337-66066359 CCCCACCACCTCCCCACTGTTGG + Intronic
1130377135 15:83339178-83339200 GACTGCCACCTGGCCACTTTGGG + Intergenic
1132406003 15:101542243-101542265 CACACCCACCTGAGCCCTTTAGG - Intergenic
1132425180 15:101710030-101710052 CACCCCCACCTGCCTCCTTAGGG + Intronic
1132710122 16:1262762-1262784 CACTCCCACCTCCCCTCATTGGG + Intergenic
1134226828 16:12397836-12397858 CACCCCCACCTCCACAGTGTGGG + Intronic
1136000826 16:27291448-27291470 CACCCCCATCATCCCAGTTTGGG - Intergenic
1136396215 16:29993897-29993919 CACCCTCACCTTCCCTCCTTTGG + Exonic
1137618408 16:49859665-49859687 ACCCCCCACCTGCCTACTTCTGG + Intergenic
1138630839 16:58293222-58293244 CCCCTCCACCTGCCCTCTGTAGG + Intronic
1139359129 16:66386424-66386446 CATCCCAACCTCCCCTCTTTTGG + Intronic
1139563287 16:67757268-67757290 CACCCCTACCCGCTCCCTTTGGG - Intronic
1140183348 16:72742992-72743014 CACCCTCACCTCCCATCTTTTGG + Intergenic
1142078068 16:88131895-88131917 CGCGCCCACCTGCCCGCTCTGGG + Intergenic
1142420713 16:89967845-89967867 CTCCCCCACCTGCCCCTTCTGGG + Exonic
1142620473 17:1162467-1162489 TACCCCCAGCTCCCCACTGTGGG + Intronic
1143410289 17:6704456-6704478 CAGCCCCAGCTTCCCACTTCTGG + Intronic
1143503096 17:7350281-7350303 CACCCCCGCCCACCCACGTTCGG + Intronic
1143572765 17:7770701-7770723 CATCCCCACCTGCCCAACCTTGG - Intronic
1144665239 17:17098077-17098099 CACCCCCAGCAGCCCACTCTTGG - Intronic
1145166398 17:20615884-20615906 CTCCCCCACCTGCCCCTTCTGGG + Intergenic
1145786663 17:27598137-27598159 GAAGCCCACCTGCCCATTTTGGG + Intronic
1145787402 17:27603200-27603222 CAGCCCCAGCTGCCCACTCTTGG + Intronic
1147142392 17:38466847-38466869 CACCCCCGCCTGCCCAACTCGGG + Exonic
1148589529 17:48805352-48805374 CACCTCCACCTGCACCCTCTAGG - Intronic
1150815622 17:68389935-68389957 ACCCCCCACCTGCACACCTTGGG + Intronic
1151259391 17:72904785-72904807 CATGCCCTCCTGCCCACCTTCGG - Intronic
1151758887 17:76089689-76089711 CACAGCCACCTGCCCACCCTGGG - Intronic
1151850078 17:76684914-76684936 CCGCCCCACCTTCCCAGTTTAGG - Intronic
1152695305 17:81741132-81741154 CACCCACGCCTGCCCCCTCTGGG + Intergenic
1154225513 18:12500122-12500144 CCTCCCAACCTCCCCACTTTTGG - Intronic
1154342420 18:13514973-13514995 CACCCCCACATTACCACTGTGGG + Intronic
1156414224 18:36870932-36870954 CACTCTTACCTGCCCACATTTGG + Intronic
1157515518 18:48308385-48308407 CCCTCCCACCTTTCCACTTTTGG + Intronic
1157633660 18:49127591-49127613 CTCCCCCTACTCCCCACTTTTGG - Intronic
1157712969 18:49862758-49862780 CACCCCCAAGTGCCCAGCTTGGG + Intronic
1157876100 18:51275100-51275122 CAGCCTCACCTACCGACTTTGGG + Intergenic
1158367242 18:56751281-56751303 CAACCCCACATGCCCGCTTTCGG - Intronic
1160686504 19:439202-439224 GCCCCCTCCCTGCCCACTTTAGG - Intronic
1160745764 19:710060-710082 GTCACCCACCTGCCCACTTCAGG + Intronic
1160984913 19:1834016-1834038 CACCCCCGCCTGCCCTCCTGGGG - Intronic
1161270158 19:3385213-3385235 CCCTCCCACCTGCCCACTGCGGG + Intronic
1161291529 19:3496298-3496320 CACCGCCCCCTGCCCAGTTGAGG + Intronic
1162323639 19:9985825-9985847 CACCCCCAGCTTCCTACCTTAGG + Exonic
1162666851 19:12220661-12220683 CACCCCTCCCTGCCCCCTGTCGG + Intergenic
1163047889 19:14658425-14658447 CATCCCCATTTGCTCACTTTGGG + Intronic
1163154713 19:15433371-15433393 CGCCCCCTCCTGCCCACTTAGGG + Intronic
1163217290 19:15890250-15890272 CTCTCCCACCTACCCACTTTGGG + Intronic
1163419630 19:17206792-17206814 CCTCCCCACCTGCCCTCTGTGGG + Intronic
1163637871 19:18445734-18445756 CCGCCCCACCTGCCACCTTTCGG - Intronic
1164529015 19:29033544-29033566 CCTCCCAACCTCCCCACTTTAGG - Intergenic
1165738834 19:38193818-38193840 CATCCCCACCTCCCAACCTTGGG - Intronic
1166784179 19:45357878-45357900 CACCCCAACCTGTCCGCTTCGGG + Intronic
1166947096 19:46404092-46404114 CACGCCCACCTGCCCCCTGCGGG - Intergenic
925193961 2:1908409-1908431 CACCTACAACTGCCCACCTTTGG - Intronic
925550993 2:5074261-5074283 CACCCTCACCTCTGCACTTTTGG + Intergenic
930059256 2:47274719-47274741 GACCCCAGCCTGCCCACTTGGGG - Intergenic
931285358 2:60827635-60827657 CACCCCCACCCCTCCACCTTAGG + Intergenic
931289684 2:60861660-60861682 CACTCACACCTGGCCAGTTTTGG + Intergenic
931591050 2:63883645-63883667 GACCCCCACCTCCCCACCCTAGG - Intronic
932024759 2:68121666-68121688 GCCCTCCACCTGCCCACCTTTGG - Intergenic
934077533 2:88440761-88440783 CACCCCCACCAACTCACTTCAGG - Intergenic
937039214 2:118807996-118808018 CTCTCCCTCCTGCCCACTCTGGG - Intergenic
937875215 2:126819934-126819956 CACCCCTAACTGCACTCTTTTGG - Intergenic
938698590 2:133856466-133856488 CAACCCCAAATGCCCATTTTAGG - Intergenic
939003157 2:136758693-136758715 CTCCCCCGCCTCCCCACCTTGGG + Intergenic
940617688 2:156070569-156070591 CACCCCCTCCTAAACACTTTAGG - Intergenic
942209004 2:173651878-173651900 CTCTCCCACCTCCCCCCTTTTGG + Intergenic
943263750 2:185698869-185698891 GACCGCCACCAGACCACTTTGGG + Intergenic
943567584 2:189534685-189534707 CACCTTCACCTGCCCTCTTCAGG + Intergenic
945095866 2:206218534-206218556 CAGCACCACCTGCCCGCTTTTGG + Intergenic
946147659 2:217743153-217743175 CACCCCCTCCAGCCCCTTTTGGG - Intronic
947651151 2:231787001-231787023 CACCCCCACCTCCTAACATTGGG + Intronic
948334045 2:237193950-237193972 CAGCTCCACCTGCACACATTTGG + Intergenic
948705539 2:239790016-239790038 CACCCCCACTTTCTCACTTTGGG + Intronic
1169204466 20:3732334-3732356 CGCCCCCACAGGCCCACCTTGGG - Intergenic
1170073100 20:12390118-12390140 CATCCCCACCTGCCCACCTCTGG - Intergenic
1170542788 20:17405881-17405903 CAACCCAACCTTCTCACTTTCGG + Intronic
1171249761 20:23638403-23638425 CATTCCCACCTCCCCACTTCGGG + Intronic
1171439115 20:25147125-25147147 CACTCCCACCTGCCCTCATGTGG - Intergenic
1172358088 20:34293559-34293581 CACCCCCTCCTGTCCACCTGTGG + Intronic
1173455561 20:43198647-43198669 CCCCCCCACTTGCTCACCTTAGG + Intergenic
1173994549 20:47327716-47327738 TCCTCCCGCCTGCCCACTTTGGG + Intronic
1174191893 20:48746618-48746640 CAGCCCCAACTGCCCACTCTGGG - Intronic
1175403303 20:58712596-58712618 CACTCCTTCCTGCCCACTGTTGG + Intronic
1175582858 20:60113845-60113867 TGCCCCCACCTGCCCAGTATCGG + Intergenic
1176035485 20:63034366-63034388 CACCCCTCCCTACCCTCTTTTGG + Intergenic
1176215964 20:63947905-63947927 CACGGCCCCCTGCCCACTTGAGG - Intronic
1177393756 21:20507927-20507949 CACCCCTGCCTGAACACTTTGGG - Intergenic
1177806476 21:25879856-25879878 CTCCCCCACCTGGAGACTTTCGG + Intergenic
1178634597 21:34291150-34291172 GACCGCCACCTAGCCACTTTGGG + Intergenic
1179317501 21:40257249-40257271 CACATCCTCCTGCACACTTTAGG + Intronic
1179485301 21:41706144-41706166 TACTCCCACCTGCCTCCTTTGGG - Intergenic
1179602692 21:42490844-42490866 CAGCCCCACCCACCAACTTTTGG + Intronic
1180801913 22:18635938-18635960 CACCCCCTCCAGGCCACATTAGG + Intergenic
1181219807 22:21359323-21359345 CACCCCCTCCAGGCCACATTAGG - Intergenic
1183365211 22:37403314-37403336 TACCACCACCTTCCCAATTTAGG + Intronic
1183484084 22:38080146-38080168 CACTCCCACCTTTCCAATTTTGG + Intronic
1183546352 22:38456201-38456223 CCTCTCCACCTGCCCCCTTTTGG - Intergenic
1183704622 22:39469128-39469150 CCCACCCACCTGCCCCCTTCTGG - Intronic
1183720718 22:39559958-39559980 CACCCCTACCTGACCACTCAAGG - Intergenic
1184214494 22:43057744-43057766 CACCCTCCCCTGCCCACTCCAGG - Intronic
1184656613 22:45944965-45944987 CACCCCCTCCTGTCCCCTATGGG + Intronic
1184695943 22:46139203-46139225 CAGTCCCTTCTGCCCACTTTGGG - Intergenic
1184805517 22:46792791-46792813 CTCCCCCACCTCCCCACATCAGG - Intronic
1185092135 22:48781588-48781610 CCGACCCACCTGCCCACTGTGGG + Intronic
1185157257 22:49201526-49201548 CACCCCCACCTCCCCCCTTGTGG + Intergenic
949539433 3:5020574-5020596 CACCCCCTCCTGCCTACTTGGGG - Intergenic
949811425 3:8011057-8011079 CCCGCCCACCACCCCACTTTGGG - Intergenic
950261899 3:11548512-11548534 CATCCCCACCTGCCCTCTATAGG + Intronic
950467443 3:13163602-13163624 CACCCCCACCTACCCTCGGTTGG + Intergenic
953992602 3:47495765-47495787 TAGCCCCAGCTGCCCATTTTTGG - Exonic
954367911 3:50155859-50155881 CACCCCCACCTTCACGCTTCTGG + Intronic
954368130 3:50156747-50156769 GGCCCCCACCTCCCCACTTCCGG - Intronic
956084810 3:65597752-65597774 CACCGCCCCCTGCCCACCTCTGG - Intronic
956947430 3:74238981-74239003 CACCTCTACCTGATCACTTTGGG - Intergenic
958761908 3:98319512-98319534 TACCACCACCTGGCCACTTTAGG - Intergenic
961648848 3:128407522-128407544 CACCCCCACCTGCCCTCAGTGGG - Intronic
961787608 3:129357120-129357142 CAGCCCCCTCTGCCCACTATAGG - Intergenic
962987329 3:140547633-140547655 CATCCCTCCCTGCCCTCTTTGGG - Intronic
965153639 3:165015879-165015901 CCCCCCCACCTGCTCATTTTAGG + Intronic
967389239 3:188939143-188939165 CAACTCCAGCTGCCCACTCTGGG + Intergenic
967447466 3:189583674-189583696 AACTCCCACTTACCCACTTTTGG + Intergenic
967959422 3:194908627-194908649 CTCCCCCAGCTGCTCCCTTTTGG + Intergenic
968480644 4:831627-831649 CAGCCCCACCTGCCCTCCTCAGG - Intergenic
968552421 4:1230429-1230451 CAGCCCCTCCTGCCCACAGTGGG - Intronic
968688540 4:1977486-1977508 CCCCCGCACCTGGCCTCTTTTGG - Intronic
970043089 4:11818762-11818784 CACCGCGCCCTGCCCACTTCAGG + Intergenic
970483307 4:16499578-16499600 CACCCTCACCTCACCATTTTAGG - Intergenic
970563322 4:17305102-17305124 CACCCCCACCTCTCCCCTTTTGG + Intergenic
973229439 4:47824905-47824927 CACACTCAGCTGCCCACGTTGGG - Intronic
973597787 4:52510466-52510488 CTCTCCCACTTTCCCACTTTTGG - Intergenic
974564997 4:63569941-63569963 GACCACCACGTGGCCACTTTTGG + Intergenic
977345579 4:95812245-95812267 TGCCCCCACCTTCCCACTGTGGG + Intergenic
980826550 4:138080630-138080652 GACCCCTACCAGCCCAGTTTGGG - Intergenic
981150214 4:141371785-141371807 CCTCCCTACCTCCCCACTTTTGG + Intergenic
985665283 5:1178911-1178933 CACCCCCACCTGCCATCCTTGGG + Intergenic
986466953 5:8035088-8035110 CAGCCCCTCCCGCCCACTCTGGG - Intergenic
989214656 5:38892003-38892025 CACCCTCACCTGAACACTGTGGG + Intronic
989369958 5:40695919-40695941 CTCCCCCACCTCCCCACTTTTGG - Intergenic
992423721 5:76633949-76633971 CACCCCCTCCCCCCAACTTTTGG + Intronic
992529236 5:77639121-77639143 CGCCCCCACCTGCGCTCTCTGGG + Exonic
993386625 5:87268869-87268891 CCCCCTTACCTGCCCCCTTTGGG + Exonic
993427981 5:87794357-87794379 CAATCCCACCTCCCCGCTTTTGG + Intergenic
994014783 5:94952734-94952756 CACCCCCAGCCCCCCATTTTTGG + Intronic
996255001 5:121389063-121389085 CACTCCCACCCCCCCAGTTTGGG - Intergenic
996665418 5:126053868-126053890 CACCCACACCACCCCCCTTTTGG - Intergenic
997282932 5:132659863-132659885 CACCCCCTCCTGCCAACCCTGGG + Intronic
998053886 5:139057476-139057498 TACCCCCACCTGCCCCCTCCTGG + Intronic
1000217792 5:159180299-159180321 CACCCTCAACTGGCCATTTTTGG + Intronic
1001254368 5:170172115-170172137 CACATCCACCTGCCAACTTCAGG - Intergenic
1001618969 5:173065921-173065943 CAACCGCACCTGGCCCCTTTGGG + Intronic
1001650346 5:173311376-173311398 CAACCCCTCATGCCCACTTCAGG + Intergenic
1001651612 5:173319937-173319959 CATGCCCACCTGCCCACCTCAGG - Intronic
1002173029 5:177385931-177385953 CCTCCCCGCCTCCCCACTTTGGG + Intronic
1002706619 5:181164874-181164896 CACCCACATCGGCCCTCTTTGGG + Intergenic
1003210409 6:4059263-4059285 AACCCCCACCTTTCCACATTTGG + Intronic
1004556177 6:16700677-16700699 CACCTCCTCCTGCCCACGTTTGG - Intronic
1006083281 6:31579828-31579850 CACCCACACTTACTCACTTTTGG + Intergenic
1006636168 6:35462775-35462797 CATCTCCACCTGCACACATTGGG - Exonic
1006781974 6:36637954-36637976 CTCCCAGACCTGCCCACTTGGGG - Intergenic
1007630374 6:43269968-43269990 CCCCCCCACCTGCCCCCTCCAGG - Intronic
1007752121 6:44077004-44077026 CACCACCACCCTCCCACTTTAGG + Intergenic
1007790688 6:44306579-44306601 CACCCCCACCTCCCCACCCTGGG + Intronic
1008013451 6:46491657-46491679 CACCCCCTCCTTTCCACTTCAGG + Intronic
1010233839 6:73558742-73558764 CACCCCCACCTGCCCTCCAGAGG - Intergenic
1012747758 6:103116557-103116579 AACTTCCACCTGACCACTTTGGG + Intergenic
1013082102 6:106821872-106821894 CAACCTCCCCTCCCCACTTTTGG - Intergenic
1014297549 6:119638518-119638540 CACCCCCACCTGTCCAAGGTTGG - Intergenic
1018723611 6:166592711-166592733 CACTCCTACCTGCCCACCTGCGG + Intronic
1019273826 7:165546-165568 CCCCCAGCCCTGCCCACTTTAGG - Intergenic
1019296901 7:282395-282417 CACCCCCTCCTTCCCGCTCTGGG - Intergenic
1019296916 7:282445-282467 CACCCCCTCCTTCCCGCTCTGGG - Intergenic
1019302567 7:314999-315021 CCCCACCCCCTGCCTACTTTCGG + Intergenic
1020014845 7:4824978-4825000 CGCCCCCACCTGCCAACCTGGGG + Intronic
1022358156 7:29635257-29635279 CACCCACACCTGGCCCCTCTGGG - Intergenic
1022368425 7:29747859-29747881 CACCCACACCTGGCCCCTCTGGG - Intergenic
1022558358 7:31323931-31323953 CACCCCGACCTGCCCGATCTAGG + Intergenic
1023152315 7:37213665-37213687 CACTCCCTCCTGCCCACAGTAGG - Intronic
1024767031 7:52671694-52671716 CAGGACCACCTGCCCACTGTGGG - Intergenic
1026963908 7:74427125-74427147 AACCCCCACCTCCCCAGGTTGGG - Intergenic
1028737799 7:94237093-94237115 CACCCCAGCCTGACCACTTCAGG - Intergenic
1028948474 7:96607644-96607666 CATCCCCAGCTGCCCACAATTGG + Intronic
1032797165 7:135287244-135287266 CCCCTCCACCTGCCCACTTTGGG + Intergenic
1032966970 7:137108884-137108906 CCCTCCCACCTTCCCATTTTGGG + Intergenic
1034787351 7:153937235-153937257 CAGCCCCACCTCCTCACTTTTGG - Intronic
1034993740 7:155565305-155565327 CACCCCTACTTGCCCACTCCTGG - Intergenic
1036212577 8:6854244-6854266 CACCCCCAGTTGCCCTCTTCGGG - Intergenic
1036765670 8:11547972-11547994 CAGCCCCACCTTCCCGCTTGTGG + Intronic
1036927134 8:12918120-12918142 CACCACCCCCTGCCAAATTTTGG + Intergenic
1041551041 8:59101971-59101993 CATCCTCACCTGCCCACAGTGGG - Intronic
1042342630 8:67696003-67696025 GACTGCCACCTGGCCACTTTGGG + Intronic
1043163933 8:76879818-76879840 GACTACCACCTGGCCACTTTGGG - Intergenic
1043360351 8:79464684-79464706 CACCCTCACATGCACACCTTGGG + Intergenic
1044263772 8:90158921-90158943 CACCCCTACCTGCCCACTCCTGG - Intergenic
1045002216 8:97888263-97888285 CACCCCCACCTGCCCACTTTTGG - Intronic
1052895300 9:33741985-33742007 GACTTCCACCTGGCCACTTTGGG - Intergenic
1056918526 9:90765032-90765054 CACTCCCACCTTCCCAGCTTAGG + Intergenic
1057801867 9:98195787-98195809 CAGCCCCACCTTCCCACCCTAGG - Intergenic
1058548355 9:106085672-106085694 CAGCCCCACCTGCACACCTCTGG - Intergenic
1059066601 9:111092072-111092094 CACCCCCAACTTCCCACTTCTGG + Intergenic
1059445978 9:114338017-114338039 CACCCCCTCTTGCCCACTGCTGG - Intronic
1060220339 9:121761134-121761156 CAGCCCCACCTACCCGGTTTGGG + Intronic
1060481985 9:124021899-124021921 CGCCCCCACCTGCCCACCCAGGG - Intronic
1060662870 9:125414540-125414562 CACACCCTCCTGCCCACCGTAGG - Intergenic
1061324971 9:129858171-129858193 CAGCTCCACCTTCCCACTCTGGG + Intronic
1061975654 9:134067138-134067160 CTTCCCCTCCTTCCCACTTTTGG - Intronic
1062047757 9:134432307-134432329 CAACCACAGCTGGCCACTTTCGG - Intronic
1062189485 9:135240518-135240540 CACCCCCACCTGGCAACGTGGGG + Intergenic
1062334408 9:136058784-136058806 AGCCCCCACCTGCACACTTCGGG + Intronic
1062431519 9:136528727-136528749 CAGCCCCACCTGCCCTCCTTGGG + Intronic
1187641477 X:21295495-21295517 CACCACCACCTGGCTAATTTGGG + Intergenic
1190824976 X:54009554-54009576 CACCGCACCCGGCCCACTTTTGG - Intronic
1192996396 X:76517210-76517232 GACTGCCACCTGGCCACTTTGGG + Intergenic
1194140629 X:90204548-90204570 AACTGCCACCTGGCCACTTTGGG - Intergenic
1195013422 X:100755117-100755139 AACTGCCACCTGACCACTTTGGG - Intergenic
1199736213 X:150689057-150689079 CACCCCCTTCTGCCCACATGGGG - Intergenic
1200067158 X:153509430-153509452 CACCCCCACTGGCCCACTGGTGG + Exonic
1200486395 Y:3773674-3773696 AACTGCCACCTGGCCACTTTGGG - Intergenic