ID: 1045002259

View in Genome Browser
Species Human (GRCh38)
Location 8:97888576-97888598
Sequence CATTATTAACAGATCTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045002259_1045002262 -3 Left 1045002259 8:97888576-97888598 CCCAGCTAGATCTGTTAATAATG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1045002262 8:97888596-97888618 ATGCTTCCCTGCATGGCAGCAGG No data
1045002259_1045002263 -2 Left 1045002259 8:97888576-97888598 CCCAGCTAGATCTGTTAATAATG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1045002263 8:97888597-97888619 TGCTTCCCTGCATGGCAGCAGGG No data
1045002259_1045002269 27 Left 1045002259 8:97888576-97888598 CCCAGCTAGATCTGTTAATAATG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1045002269 8:97888626-97888648 GAGCTGGGCCAGAAGAGAGGTGG No data
1045002259_1045002267 12 Left 1045002259 8:97888576-97888598 CCCAGCTAGATCTGTTAATAATG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1045002267 8:97888611-97888633 GCAGCAGGGAAGTAAGAGCTGGG No data
1045002259_1045002266 11 Left 1045002259 8:97888576-97888598 CCCAGCTAGATCTGTTAATAATG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1045002266 8:97888610-97888632 GGCAGCAGGGAAGTAAGAGCTGG No data
1045002259_1045002270 28 Left 1045002259 8:97888576-97888598 CCCAGCTAGATCTGTTAATAATG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1045002270 8:97888627-97888649 AGCTGGGCCAGAAGAGAGGTGGG No data
1045002259_1045002268 24 Left 1045002259 8:97888576-97888598 CCCAGCTAGATCTGTTAATAATG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1045002268 8:97888623-97888645 TAAGAGCTGGGCCAGAAGAGAGG No data
1045002259_1045002271 29 Left 1045002259 8:97888576-97888598 CCCAGCTAGATCTGTTAATAATG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1045002271 8:97888628-97888650 GCTGGGCCAGAAGAGAGGTGGGG No data
1045002259_1045002261 -10 Left 1045002259 8:97888576-97888598 CCCAGCTAGATCTGTTAATAATG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1045002261 8:97888589-97888611 GTTAATAATGCTTCCCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045002259 Original CRISPR CATTATTAACAGATCTAGCT GGG (reversed) Intronic
908089981 1:60675811-60675833 CATTATTAGCACATCTAATTTGG - Intergenic
921723315 1:218497660-218497682 CCTTAATAAGAGATGTAGCTGGG + Intergenic
921891281 1:220356320-220356342 AAATAATAACAGAACTAGCTAGG - Intergenic
922671689 1:227513076-227513098 AATTATTAAAAGACCTGGCTGGG + Intergenic
1064358330 10:14640036-14640058 TATTATTAACAGATACAGATGGG - Intronic
1073704672 10:105969754-105969776 AATTAGTAACAGAGCCAGCTGGG - Intergenic
1077960319 11:7070106-7070128 CATTATTACCAGATATTTCTAGG - Intronic
1085114760 11:73921002-73921024 GATTATTAACATCTCTGGCTGGG + Intronic
1085927714 11:81041118-81041140 CATTACTAACAGCTCCAACTTGG + Intergenic
1090978029 11:131692490-131692512 CATTATTCAGAGATCTGCCTGGG - Intronic
1094214471 12:27925757-27925779 CATTATTTACATATATAGTTTGG - Intergenic
1094243604 12:28259893-28259915 CATTATTGACAGATGTTTCTTGG + Intronic
1095211872 12:39503819-39503841 CTTTCTTAAAAGATCTGGCTGGG + Intergenic
1098801691 12:74967858-74967880 CATTACTACCAGATCTGCCTTGG + Intergenic
1100182892 12:92104701-92104723 AATTAATAACAGATGTAGGTGGG + Intronic
1101733353 12:107444528-107444550 GACTAATAACAGATCTACCTTGG - Intronic
1104129359 12:125878083-125878105 CATCATTAACACAGCTAACTAGG + Intergenic
1104769933 12:131355069-131355091 CATTTTTTCCAGATCTATCTTGG + Intergenic
1106582952 13:31033519-31033541 CAGTATTAACAGAGATGGCTAGG + Intergenic
1109607998 13:64723410-64723432 AATTATTAACACAGCTGGCTTGG + Intergenic
1111707878 13:91774366-91774388 CATCATTAACAGATCTTTATTGG + Intronic
1115769392 14:36654871-36654893 CATAATTAACACAGCTAGCTGGG - Intergenic
1115918981 14:38350870-38350892 CATAATTAACAGATATGTCTTGG + Intergenic
1116143351 14:41030614-41030636 CATTGTTTACAGATATAGGTTGG - Intergenic
1119502406 14:75141144-75141166 CATTAAAAACAGTTCTAGTTGGG + Intronic
1123973339 15:25529199-25529221 CATTGATAACTGATCTAGATGGG + Intergenic
1127889272 15:63234495-63234517 CATAGTTAACAGATCTAACAGGG - Intronic
1128559476 15:68655221-68655243 TATTATTAAAAGATCCAGGTTGG + Intronic
1131407602 15:92178120-92178142 AATTTTTAACAGAGCTAACTTGG + Intergenic
1134088699 16:11377339-11377361 CTTTCTTAATAGCTCTAGCTAGG + Intronic
1134887607 16:17807707-17807729 CATTTTTAACATATCTAGCATGG + Intergenic
1135887630 16:26325847-26325869 CATTATCAAAATATCTATCTAGG + Intergenic
1146195604 17:30809975-30809997 CATAATTTACAGATTTATCTGGG - Intronic
1148118304 17:45191415-45191437 AATTATTAAAAGATTTGGCTGGG + Intergenic
1149754215 17:59174272-59174294 CATTAGAAACGGATCTAGCATGG - Intronic
1150095140 17:62367383-62367405 CATTATTTAGAGATCTTGCAGGG - Intergenic
1153181033 18:2433628-2433650 CATTATGAACAGATCTATAAAGG + Intergenic
1155118198 18:22791450-22791472 CATTATTAACAGACCCTGATGGG - Intergenic
1158238096 18:55342254-55342276 TATTATTAACAGATACAGTTGGG - Intronic
1158351327 18:56567433-56567455 CATTGTGAACAGTTCTTGCTGGG - Intergenic
1160495664 18:79373388-79373410 CATTTCTAACTGATGTAGCTAGG + Intronic
1164818222 19:31223319-31223341 CATCATTCACAGACCTACCTGGG - Intergenic
1165294339 19:34914487-34914509 AAATATTAAAAGGTCTAGCTGGG + Intergenic
1165931790 19:39363932-39363954 CATTATTTACAGCCCCAGCTGGG + Intronic
926087773 2:10030888-10030910 CATTAGTTAAAGATCTAACTAGG + Intergenic
926837861 2:17044426-17044448 CACTATTACCAGCTGTAGCTGGG + Intergenic
928761251 2:34586152-34586174 CATTAGTAGCAGCTCTACCTGGG + Intergenic
929920281 2:46166693-46166715 AATTATTAACAGGAATAGCTGGG + Intronic
930289038 2:49470087-49470109 CCTTCTTAACTGCTCTAGCTAGG - Intergenic
930920088 2:56742572-56742594 CATTATTAACAGATGTCACCTGG - Intergenic
933309718 2:80645339-80645361 CATTATTTACACTTCTACCTGGG + Intronic
934987382 2:98897606-98897628 CATTATTTACAAACCTAACTTGG + Intronic
939879873 2:147618426-147618448 TATTTTTAACAGATTTTGCTTGG - Intergenic
942693523 2:178612830-178612852 CCTTATTCACAGCTCTAACTCGG + Exonic
943997745 2:194793376-194793398 CACTATTCACAGATCAAACTAGG + Intergenic
944182740 2:196913250-196913272 CATTTTTAACAGGTATATCTTGG + Intronic
944728221 2:202493909-202493931 CATTTTGAATAGATCTAGCTTGG - Intronic
948160839 2:235822779-235822801 CATTCTCACCAGATCTATCTGGG - Intronic
948527161 2:238578251-238578273 AATTATCAACAATTCTAGCTTGG + Intergenic
1170158288 20:13288041-13288063 CATAATTCACAGGTCTAGCATGG + Intronic
1171820039 20:29827378-29827400 TATTTTTAACAGCTCTAGTTAGG - Intergenic
1177161191 21:17550059-17550081 TATAAATAAAAGATCTAGCTGGG + Intronic
1180690006 22:17706004-17706026 AATTATTAACAGAAATGGCTAGG + Intronic
1181939869 22:26467018-26467040 CAATATTAATAGTACTAGCTTGG - Intronic
1183031024 22:35104624-35104646 CGTTATTAACAGATTTCGATGGG - Intergenic
1184497929 22:44853658-44853680 CCTTATTAAAAGTTCTAGCAAGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949620619 3:5807836-5807858 TATTATTAAGAAATCTGGCTGGG + Intergenic
951220034 3:20059116-20059138 TATTATTAAAATATCTTGCTGGG + Intronic
954335671 3:49915842-49915864 CAGTGGTAACAGAGCTAGCTGGG + Intronic
955991859 3:64636367-64636389 CATTATTAAGAGGCATAGCTGGG - Intronic
961577873 3:127853235-127853257 CATTTTAAACAGAAATAGCTGGG - Intergenic
962359792 3:134728789-134728811 AAATATTAACAGATTTATCTTGG + Intronic
964043204 3:152289382-152289404 CATAATTCACATATCTAACTAGG - Intronic
966111842 3:176412374-176412396 CATTATTAAAAGAACTATCATGG - Intergenic
971597912 4:28555540-28555562 CATTAGTAAAAGGTCTAGATTGG - Intergenic
974208198 4:58735097-58735119 CATTAATAATTGATATAGCTAGG + Intergenic
976485765 4:85602248-85602270 TTTGATTATCAGATCTAGCTTGG - Intronic
977609272 4:99015802-99015824 TATTATTAACATAACTAGATTGG - Intronic
978269334 4:106870175-106870197 CATTGGTAACAGACCTAGTTTGG - Intergenic
979447253 4:120828756-120828778 TATTAATATCAGATGTAGCTAGG - Intronic
980386735 4:132094980-132095002 CATTATTAACAGACCTACTAAGG + Intergenic
980415022 4:132476200-132476222 CATAATTAACAGAAATTGCTGGG - Intergenic
984839439 4:184054169-184054191 CAATATTAACAGAACAGGCTGGG - Intergenic
995230226 5:109752858-109752880 GATTATTAACAAATGGAGCTGGG + Intronic
1002409628 5:179063261-179063283 CATTAGTAACAGTAGTAGCTGGG + Intronic
1013457982 6:110349293-110349315 CATTATTAAAAGCTCTAGCCTGG - Intronic
1015322500 6:131892322-131892344 CATTATTACCAGGTGTGGCTAGG + Exonic
1019230369 6:170555349-170555371 CAGTATGAACAGATCTAATTTGG - Intronic
1020044486 7:5031061-5031083 CAGTAGAAACAGATCTAGCATGG - Intronic
1020289844 7:6715083-6715105 CATTAGAAACAGATCTAGCATGG - Intergenic
1023825861 7:44008293-44008315 CATTAGAAACACATCTAGCATGG + Intronic
1024128146 7:46322010-46322032 CATTCTTAACTGATCTTTCTAGG - Intergenic
1026089431 7:67287144-67287166 CATTAGAAACACATCTAGCATGG + Intergenic
1026634318 7:72067981-72068003 CATTATTTACAAGTCTGGCTTGG + Intronic
1026724850 7:72863356-72863378 CATTAAAAACACATCTAGCATGG - Intergenic
1026746981 7:73021552-73021574 CGTTAGAAACAGATCTAGCACGG - Intergenic
1026750633 7:73049695-73049717 CGTTAGAAACAGATCTAGCACGG - Intergenic
1026754280 7:73077805-73077827 CGTTAGAAACAGATCTAGCACGG - Intergenic
1026757932 7:73105838-73105860 CGTTAGAAACAGATCTAGCACGG - Intergenic
1027033085 7:74906123-74906145 CATTAGAAACAGATCTAGCACGG - Intergenic
1027089471 7:75287646-75287668 CGTTAGAAACAGATCTAGCACGG + Intergenic
1027093116 7:75315574-75315596 CGTTAGAAACAGATCTAGCACGG + Intergenic
1027096759 7:75343541-75343563 CGTTAGAAACAGATCTAGCACGG + Intergenic
1027119025 7:75502462-75502484 CATTAGAAACACATCTAGCATGG + Intergenic
1027272800 7:76533146-76533168 CATTAGAAACACATCTAGCATGG - Intergenic
1027326249 7:77052231-77052253 CATTAGAAACACATCTAGCATGG - Intergenic
1028597652 7:92563646-92563668 CCTCATTAACAGCTCTACCTGGG + Intronic
1029718472 7:102347555-102347577 CATTAGAAACACATCTAGCATGG - Intergenic
1029754144 7:102561700-102561722 CATTAGAAACACATCTAGCATGG + Intronic
1029772094 7:102660790-102660812 CATTAGAAACACATCTAGCATGG + Intronic
1031498724 7:122484960-122484982 CATTATTAGTAGATCTATCACGG + Intronic
1032877921 7:136057541-136057563 AATTATGAACACATCTGGCTGGG - Intergenic
1034206641 7:149321849-149321871 CAGTGGTAACAGATCAAGCTTGG + Intergenic
1040695309 8:49990075-49990097 CATTATTAGAAGTTCTAGCAAGG + Intronic
1040727748 8:50403211-50403233 CCTTATTAACAGACTTACCTTGG + Intronic
1041432758 8:57802498-57802520 CATTATCAACAAACCTTGCTAGG + Intergenic
1042992833 8:74659843-74659865 CATTAATAATATATTTAGCTTGG - Intronic
1043169017 8:76940633-76940655 CACTTTTAATACATCTAGCTAGG - Intergenic
1043336580 8:79183443-79183465 CATTTTGAACATGTCTAGCTTGG + Intergenic
1045002259 8:97888576-97888598 CATTATTAACAGATCTAGCTGGG - Intronic
1045597026 8:103668839-103668861 CATTATTAAAAGCTCTAGCTGGG - Intronic
1049398689 8:142415159-142415181 CCTCCTTAACAGATCCAGCTGGG - Intergenic
1050419610 9:5449870-5449892 CATTCTTAAAAGATGTAGCTCGG + Intergenic
1050547385 9:6720348-6720370 AAATATTAATACATCTAGCTGGG - Intergenic
1050847347 9:10238744-10238766 CATAATTAACAAAATTAGCTTGG - Intronic
1050952234 9:11612394-11612416 AATAATTGGCAGATCTAGCTAGG - Intergenic
1052173196 9:25427022-25427044 CATTATTAACAGATCTTTAGAGG + Intergenic
1053187965 9:36035041-36035063 CATTATTAACAGTTGCGGCTGGG - Intergenic
1057539312 9:95950525-95950547 CATAATTAAAAGATGTAGATTGG + Intronic
1061686096 9:132280134-132280156 TATTTTTAACAGATATTGCTAGG - Intronic
1186946850 X:14578158-14578180 CATTATTAAAAGTTTTAGTTTGG + Intronic
1187185169 X:16977553-16977575 AATTTTTAAAAAATCTAGCTGGG + Intronic
1195947680 X:110232593-110232615 CACAATTAAAAGAACTAGCTGGG + Intronic
1198500307 X:137238099-137238121 CTTTATTAAAAGAAATAGCTGGG + Intergenic
1202379772 Y:24266054-24266076 CTTTGTTAACAAATTTAGCTGGG - Intergenic
1202491010 Y:25404067-25404089 CTTTGTTAACAAATTTAGCTGGG + Intergenic