ID: 1045003207

View in Genome Browser
Species Human (GRCh38)
Location 8:97896068-97896090
Sequence CTGCTGCAGCCGGTCACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045003199_1045003207 12 Left 1045003199 8:97896033-97896055 CCATAGAATGCCCTGCCCATCTG 0: 1
1: 0
2: 4
3: 11
4: 149
Right 1045003207 8:97896068-97896090 CTGCTGCAGCCGGTCACACCTGG No data
1045003201_1045003207 2 Left 1045003201 8:97896043-97896065 CCCTGCCCATCTGTATTTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 130
Right 1045003207 8:97896068-97896090 CTGCTGCAGCCGGTCACACCTGG No data
1045003205_1045003207 -4 Left 1045003205 8:97896049-97896071 CCATCTGTATTTGGAGGTGCTGC 0: 1
1: 0
2: 1
3: 33
4: 316
Right 1045003207 8:97896068-97896090 CTGCTGCAGCCGGTCACACCTGG No data
1045003204_1045003207 -3 Left 1045003204 8:97896048-97896070 CCCATCTGTATTTGGAGGTGCTG 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1045003207 8:97896068-97896090 CTGCTGCAGCCGGTCACACCTGG No data
1045003203_1045003207 1 Left 1045003203 8:97896044-97896066 CCTGCCCATCTGTATTTGGAGGT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1045003207 8:97896068-97896090 CTGCTGCAGCCGGTCACACCTGG No data
1045003198_1045003207 30 Left 1045003198 8:97896015-97896037 CCAGAGTTTTTGTGTAGACCATA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1045003207 8:97896068-97896090 CTGCTGCAGCCGGTCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045003207 Original CRISPR CTGCTGCAGCCGGTCACACC TGG Intronic
No off target data available for this crispr