ID: 1045008109

View in Genome Browser
Species Human (GRCh38)
Location 8:97933534-97933556
Sequence CTATTCGACACCAGGATTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045008109_1045008113 -8 Left 1045008109 8:97933534-97933556 CCCGCAATCCTGGTGTCGAATAG 0: 1
1: 0
2: 1
3: 4
4: 40
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008109_1045008116 30 Left 1045008109 8:97933534-97933556 CCCGCAATCCTGGTGTCGAATAG 0: 1
1: 0
2: 1
3: 4
4: 40
Right 1045008116 8:97933587-97933609 AACCATCTCTGTGTGCTTTCTGG No data
1045008109_1045008114 4 Left 1045008109 8:97933534-97933556 CCCGCAATCCTGGTGTCGAATAG 0: 1
1: 0
2: 1
3: 4
4: 40
Right 1045008114 8:97933561-97933583 TACCAATGTGGACTTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045008109 Original CRISPR CTATTCGACACCAGGATTGC GGG (reversed) Intronic
912645881 1:111391376-111391398 CTATTCCACACCAGGAATTCTGG - Intergenic
921904045 1:220477559-220477581 CTACTTGTCACCAGGATAGCAGG - Intergenic
924381028 1:243464570-243464592 CTATTTCAAACCAGTATTGCTGG + Intronic
1063034615 10:2273833-2273855 CTATTCGACATCATGCTTGAGGG + Intergenic
1065659148 10:27987733-27987755 CTATTGGTCACTAGGCTTGCTGG - Intronic
1067830259 10:49607600-49607622 CTACACTGCACCAGGATTGCAGG + Intergenic
1090665174 11:128910228-128910250 CTATCAGACACCTGTATTGCAGG + Intronic
1108003351 13:45924381-45924403 CAATGGGACACCAGGTTTGCTGG - Intergenic
1116616074 14:47141275-47141297 CTATCCAACAGTAGGATTGCTGG - Intronic
1117690149 14:58298226-58298248 CAGTTCGACACGAGGATTGGCGG - Intergenic
1118844488 14:69536632-69536654 ATAATCTACACCAGGATTGGAGG - Intergenic
1124209889 15:27753940-27753962 CTATCCCACATCAGGATGGCTGG - Intergenic
1126961782 15:54004520-54004542 ATATCCAACAGCAGGATTGCAGG + Intergenic
1141169422 16:81681697-81681719 TTATTGCACACCTGGATTGCAGG + Intronic
1141707907 16:85679077-85679099 CTATTCCCCACCAGGAATCCAGG + Intronic
1150217356 17:63477908-63477930 CTATTGGGCACCAGGAGGGCAGG - Intergenic
1150957378 17:69874143-69874165 CTAGTTGTCACCATGATTGCAGG - Intergenic
1152310007 17:79544352-79544374 CTATTCAACACGGTGATTGCTGG + Intergenic
1152809516 17:82374967-82374989 CTCTTCGCCACCAGCATCGCGGG + Exonic
1157712753 18:49861174-49861196 CTATTGTACACCAGGCTTGCTGG + Intronic
927101784 2:19793340-19793362 GTATTTGACACCAGGGTTGTTGG + Intergenic
927332542 2:21882855-21882877 CTATGCTTCCCCAGGATTGCTGG + Intergenic
928290471 2:30032754-30032776 CTATTGGGCAGCAGAATTGCTGG - Intergenic
930724623 2:54670678-54670700 TTATGGGACTCCAGGATTGCTGG - Intronic
948687540 2:239678294-239678316 CTCTTCTGCACCACGATTGCCGG - Intergenic
1171027232 20:21641645-21641667 TTATTCGACAACAGGAATGTGGG - Intergenic
952600611 3:35077308-35077330 ATATTCAAAAACAGGATTGCTGG - Intergenic
962947108 3:140182219-140182241 CTATTCAAGGCAAGGATTGCTGG + Intronic
977200517 4:94109332-94109354 CCATTGGGCACCAGGATTTCAGG + Intergenic
992497131 5:77305192-77305214 CTATTTGACACCAAGATAACTGG - Intronic
996107968 5:119528679-119528701 CTATTCATCACCAGAATTGCAGG - Intronic
999986181 5:157007599-157007621 CTTTTCCACACTAGGGTTGCCGG + Intergenic
1012739202 6:102992917-102992939 CTAGTAGACACCAGTATTGCTGG + Intergenic
1014734032 6:125070365-125070387 ATATTCAGCAGCAGGATTGCTGG + Intronic
1024975074 7:55106204-55106226 CAAATCCACTCCAGGATTGCAGG - Intronic
1026583872 7:71640122-71640144 CTATTCCACTCCAGTATTGATGG + Intronic
1029316072 7:99715525-99715547 ATATACGACAACAGGATTTCTGG + Intronic
1042197227 8:66241463-66241485 CAATTCGACACGAGACTTGCGGG - Intergenic
1045008109 8:97933534-97933556 CTATTCGACACCAGGATTGCGGG - Intronic
1049535715 8:143180442-143180464 CAATTCAAAACCAGGATTTCAGG + Intergenic
1053007028 9:34611559-34611581 CTCTTGGACTCCAGGATTGGAGG - Intronic
1060397876 9:123328789-123328811 CTTTTAGAAACCAGGACTGCTGG + Intergenic
1186079362 X:5913192-5913214 CTTTTTGACACCAGGAATCCTGG + Intronic
1188965424 X:36545581-36545603 CTAGGAGACACTAGGATTGCAGG + Intergenic
1189371850 X:40434961-40434983 CTATGCGCCACCAGGATTGCGGG + Intergenic
1196619375 X:117805098-117805120 ACATTTGACACCAGGTTTGCAGG + Intergenic