ID: 1045008110

View in Genome Browser
Species Human (GRCh38)
Location 8:97933535-97933557
Sequence CCTATTCGACACCAGGATTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045008110_1045008113 -9 Left 1045008110 8:97933535-97933557 CCGCAATCCTGGTGTCGAATAGG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008110_1045008114 3 Left 1045008110 8:97933535-97933557 CCGCAATCCTGGTGTCGAATAGG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1045008114 8:97933561-97933583 TACCAATGTGGACTTGTCTGTGG No data
1045008110_1045008116 29 Left 1045008110 8:97933535-97933557 CCGCAATCCTGGTGTCGAATAGG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1045008116 8:97933587-97933609 AACCATCTCTGTGTGCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045008110 Original CRISPR CCTATTCGACACCAGGATTG CGG (reversed) Intronic
901189806 1:7402888-7402910 CCTTTTCCACAGCAGGAATGGGG + Intronic
902884237 1:19393435-19393457 CCTATTCGGAGGCAGGATTGAGG + Intronic
916339485 1:163713356-163713378 CCTATTCTATATTAGGATTGTGG - Intergenic
918904640 1:190476590-190476612 CCTATTAAACACAAGGGTTGGGG + Intronic
1063034614 10:2273832-2273854 CCTATTCGACATCATGCTTGAGG + Intergenic
1063660429 10:8032002-8032024 CCTATTCAACACCATGATGAAGG + Intergenic
1064448036 10:15413972-15413994 CATATTCGACCACAGGAGTGAGG - Intergenic
1088576099 11:111272741-111272763 CCTACTCTGCACCAGGATTGTGG - Intronic
1095968648 12:47885993-47886015 CCTAATCGACCCCAGGAGAGGGG + Intronic
1097700006 12:62810240-62810262 CCTACCCTACTCCAGGATTGGGG + Intronic
1100377134 12:94027888-94027910 CCTGTTTGACACCTGGATTGTGG + Intergenic
1100741711 12:97601015-97601037 CCTGTTAGACATCAGGATAGTGG - Intergenic
1101932110 12:109023193-109023215 CCCACCTGACACCAGGATTGAGG - Intronic
1106780024 13:33049908-33049930 CCTGTTTTACAGCAGGATTGTGG - Intronic
1115119676 14:29925927-29925949 CCTTTTCCACATCAGTATTGTGG - Intronic
1125267693 15:37901967-37901989 CCTCTTGGACCCCAGGTTTGTGG + Intergenic
1133410154 16:5561561-5561583 CCTATTAGACACCAGGGAAGGGG + Intergenic
1135153434 16:20031073-20031095 CCTTTTAGACCCCAGGTTTGAGG + Intergenic
1140893795 16:79307487-79307509 CCTGTTGGAAACCAGAATTGAGG + Intergenic
1151426710 17:74035409-74035431 CCCATTCGACAGCAGGGCTGAGG - Intergenic
1155320444 18:24613688-24613710 CTTATTCGACACCAAGTTTTTGG + Intergenic
1158632633 18:59129411-59129433 CCTATTGTAAACCAGGCTTGAGG + Intergenic
1160380207 18:78448797-78448819 CCTATTAGAAACCATGATTTGGG - Intergenic
1161975204 19:7604691-7604713 ACTCTTCAACACCAGGACTGGGG - Intronic
1162331236 19:10031083-10031105 CCGATTTGACACCAGAGTTGGGG + Intergenic
929623357 2:43380682-43380704 GGTATTCGAAACCAAGATTGGGG - Intronic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
948342290 2:237263590-237263612 GCCACTCGACATCAGGATTGTGG - Intergenic
1171027233 20:21641646-21641668 TTTATTCGACAACAGGAATGTGG - Intergenic
1179314398 21:40228789-40228811 CCTATTAGAAACCAAGATTTGGG + Intronic
951083361 3:18479210-18479232 CCTATTCTACACCAAGAGTTAGG + Intergenic
955080887 3:55656970-55656992 ACTATTCCACAGCAGGATGGTGG + Intronic
962686040 3:137848484-137848506 CCTATTCAACAAAAGAATTGAGG - Intergenic
964476378 3:157101279-157101301 CCTCTGCGACTCCAGGTTTGGGG - Intergenic
965622387 3:170654635-170654657 CCTCTTCCACCCCAGGAATGGGG + Intronic
971928239 4:33042834-33042856 CCTATTAAACACAATGATTGAGG - Intergenic
980719311 4:136673002-136673024 CCTATTAGACACAGGGTTTGAGG + Intergenic
985623416 5:968716-968738 CAAATTCGACACCCGGTTTGTGG + Intergenic
997310853 5:132880957-132880979 CCTAGTCGACACTAAGAATGAGG - Exonic
1001650688 5:173313941-173313963 CCTATTTTACACGAGGCTTGGGG - Intergenic
1006435439 6:34023634-34023656 CTTACTCCACACCAGGACTGGGG + Intronic
1006818922 6:36874869-36874891 CCCTTTCGATACCAGGATTTGGG + Exonic
1017239613 6:152152634-152152656 CCTAATGGACAGCAGAATTGAGG - Intronic
1018404387 6:163462783-163462805 ATTATTCCATACCAGGATTGTGG - Intronic
1018517451 6:164601365-164601387 CCTCTGAGACACCAGTATTGAGG - Intergenic
1037893830 8:22638585-22638607 CCTTTTGGACAGCAGGAATGAGG + Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1047525601 8:125631756-125631778 CCTATTCAGCTCCAGGAGTGTGG - Intergenic
1050086173 9:1968091-1968113 GCTATTCAACACCACGACTGTGG + Intergenic
1058624548 9:106921188-106921210 CCTGTTCTACATCAGGATTTAGG - Intronic
1062053555 9:134459244-134459266 CCTATGGGAGACCAGGATGGCGG + Intergenic
1189371849 X:40434960-40434982 GCTATGCGCCACCAGGATTGCGG + Intergenic
1194614235 X:96081764-96081786 ACTATTCGACAAAAAGATTGGGG + Intergenic