ID: 1045008112

View in Genome Browser
Species Human (GRCh38)
Location 8:97933542-97933564
Sequence GGTATATCCTATTCGACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045008112_1045008118 27 Left 1045008112 8:97933542-97933564 CCTGGTGTCGAATAGGATATACC 0: 1
1: 0
2: 0
3: 11
4: 60
Right 1045008118 8:97933592-97933614 TCTCTGTGTGCTTTCTGGCAAGG No data
1045008112_1045008114 -4 Left 1045008112 8:97933542-97933564 CCTGGTGTCGAATAGGATATACC 0: 1
1: 0
2: 0
3: 11
4: 60
Right 1045008114 8:97933561-97933583 TACCAATGTGGACTTGTCTGTGG No data
1045008112_1045008116 22 Left 1045008112 8:97933542-97933564 CCTGGTGTCGAATAGGATATACC 0: 1
1: 0
2: 0
3: 11
4: 60
Right 1045008116 8:97933587-97933609 AACCATCTCTGTGTGCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045008112 Original CRISPR GGTATATCCTATTCGACACC AGG (reversed) Intronic
908310517 1:62877426-62877448 GGTATATCCGACTCGGCACAAGG + Intergenic
913934832 1:125026973-125026995 GGTATTTCCTTTTCCACAACAGG - Intergenic
916991128 1:170246832-170246854 GGTATAGCCTACTACACACCTGG - Intergenic
917032106 1:170704738-170704760 GGTATAGTCTATTACACACCAGG - Intronic
921239886 1:213168358-213168380 AGTATATGCTATTGGTCACCTGG + Intronic
922653128 1:227358058-227358080 GGTATATAATATTTGGCACCCGG - Intergenic
1065659150 10:27987741-27987763 GTTATATCCTATTGGTCACTAGG - Intronic
1071892097 10:90020677-90020699 GGTATATCCTACTGCATACCTGG + Intergenic
1074728691 10:116344303-116344325 GGGATAACCTATTACACACCTGG + Intronic
1083073409 11:60011138-60011160 GGTATAGCCTACTACACACCTGG - Intergenic
1088958971 11:114641812-114641834 GGTATATCACATCTGACACCAGG + Intergenic
1097901873 12:64881497-64881519 GGTATAGCCTACTACACACCTGG + Intergenic
1107275709 13:38676849-38676871 GTTATAGCCTACTCCACACCTGG + Intergenic
1107454790 13:40545211-40545233 GGTATAGCCTACTACACACCTGG - Intergenic
1108062496 13:46547538-46547560 GGTATATCCTATTATGCACCTGG - Intergenic
1110642042 13:77836394-77836416 GGTCTATCATCTTCAACACCTGG + Intergenic
1110933089 13:81247933-81247955 GGTATAACCTACTGCACACCTGG + Intergenic
1118960804 14:70529503-70529525 GGTATAGCCTACTATACACCTGG + Intronic
1127108194 15:55640134-55640156 GGTATAGCCTACTGCACACCTGG + Intronic
1127691001 15:61397705-61397727 GGTATAGCCTACTGCACACCTGG - Intergenic
1133708566 16:8379135-8379157 AGTATATGCTAGTTGACACCTGG + Intergenic
1136915617 16:34192431-34192453 GGTATTTCCTTTTCCACAACAGG + Intergenic
1137680489 16:50339349-50339371 GGTATAGCCTATCAGACACCTGG + Intronic
1149006725 17:51813744-51813766 GGTATATCCTATGGGACATTAGG - Intronic
1149083541 17:52686546-52686568 GGTATACCCTATTCAACAGCTGG - Intergenic
1155732863 18:29183186-29183208 GGTATAGCCTACTACACACCTGG - Intergenic
1162734327 19:12737688-12737710 GGTATATCCTACACGCCTCCTGG - Intronic
930663722 2:54081548-54081570 GGTATAGCCTACTCCACACCTGG - Intronic
933025693 2:77255668-77255690 GGGATATTCTATTCGACACATGG - Intronic
941470335 2:165877555-165877577 GGTAGATCCTACTACACACCTGG - Intronic
1169409412 20:5354779-5354801 GGTATAACCTCTTCAACAACAGG + Intergenic
1177066720 21:16446389-16446411 GGTATAGCCTATTACACACATGG - Intergenic
1177723185 21:24933922-24933944 GGTATAACCTACTACACACCTGG - Intergenic
1182174829 22:28274040-28274062 AGTATATCCTTTTCTATACCTGG - Intronic
951561657 3:23973314-23973336 GGTATATCCTACTACACACCTGG + Intronic
952265504 3:31782188-31782210 GGGATATCCTATTCAACAAATGG + Intronic
958032620 3:88131080-88131102 GGTATATCCTACTGCACATCTGG + Intronic
958209639 3:90454875-90454897 GATATTTCCTATTCCACCCCAGG + Intergenic
958211088 3:90476866-90476888 GATATTTCCTATTCCACCCCAGG + Intergenic
959023080 3:101210319-101210341 GGTATAGCCTATTACACACCCGG - Intergenic
960091116 3:113639213-113639235 GGTATAGCCTACTACACACCTGG + Intergenic
960592898 3:119382298-119382320 GGAATACCTGATTCGACACCTGG + Exonic
967962182 3:194934574-194934596 GGTGTAGCCTATTAGACACCTGG - Intergenic
974242289 4:59265867-59265889 GGCATATTCTATTAGACAACTGG + Intergenic
975171598 4:71238031-71238053 GGTATCTCCTCTTTGACACTGGG - Intronic
975323518 4:73035204-73035226 GGTATAGCCTACTACACACCTGG + Intergenic
976626760 4:87192731-87192753 GGTATAGCCTATTACATACCTGG + Intronic
978509539 4:109501280-109501302 GGTATAGCCTACTACACACCTGG - Intronic
979211042 4:118103552-118103574 GGTATATCCTTCCCCACACCAGG + Intronic
980263618 4:130486985-130487007 GGTATAGCCTACTACACACCTGG - Intergenic
986702292 5:10422436-10422458 GGTATATCTTATTAGACACGGGG + Intronic
991303844 5:65155367-65155389 GGTATAGCCTATTGTACACCTGG + Intronic
992726627 5:79613769-79613791 GGAATATCCTGTTCAAAACCTGG + Intronic
992938222 5:81734391-81734413 GGTATATTCTAAATGACACCAGG + Intronic
996901096 5:128542371-128542393 GGTATATCCCATTCTAGATCTGG - Intronic
1014058809 6:117047367-117047389 GATGTATCCTATATGACACCTGG + Intergenic
1018285991 6:162238323-162238345 GGTATAGCCTACTGCACACCTGG - Intronic
1025499221 7:61263462-61263484 GGTATATCCTTTTCCACAGAAGG - Intergenic
1030102502 7:105958683-105958705 GGTATAGCCTATTACACACCTGG + Intronic
1032099435 7:128961427-128961449 GGTATAGCCTACCGGACACCTGG - Intronic
1032158841 7:129494342-129494364 GGTATAGCCTACTGCACACCTGG + Intergenic
1033142068 7:138836369-138836391 GGTATAGCCTACTACACACCTGG - Intronic
1037954535 8:23043876-23043898 GGTGTATCCTATGACACACCTGG + Intronic
1044127879 8:88480696-88480718 GGTATAGCCTATTGTACATCTGG - Intergenic
1045008112 8:97933542-97933564 GGTATATCCTATTCGACACCAGG - Intronic
1045333759 8:101180140-101180162 GGTGTATCCTACTCTACACAGGG - Intronic
1046657973 8:116916380-116916402 GGTATAGCCTACTACACACCTGG + Intergenic
1047417346 8:124675428-124675450 GGTACACCCTATTCATCACCAGG - Intronic
1048115704 8:131519572-131519594 GGTATTTTCTATTTTACACCTGG + Intergenic
1049336149 8:142087125-142087147 GGTATAGCCTACTACACACCTGG + Intergenic
1060357533 9:122924013-122924035 GGTATAGCCTACTACACACCTGG - Intronic
1191569308 X:62588748-62588770 GGTATATCCTTTTCCACAGTAGG - Intergenic