ID: 1045008113

View in Genome Browser
Species Human (GRCh38)
Location 8:97933549-97933571
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045008103_1045008113 0 Left 1045008103 8:97933526-97933548 CCCCCACCCCCGCAATCCTGGTG 0: 1
1: 1
2: 0
3: 26
4: 257
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008108_1045008113 -7 Left 1045008108 8:97933533-97933555 CCCCGCAATCCTGGTGTCGAATA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008102_1045008113 1 Left 1045008102 8:97933525-97933547 CCCCCCACCCCCGCAATCCTGGT 0: 1
1: 0
2: 1
3: 36
4: 341
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008110_1045008113 -9 Left 1045008110 8:97933535-97933557 CCGCAATCCTGGTGTCGAATAGG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008105_1045008113 -2 Left 1045008105 8:97933528-97933550 CCCACCCCCGCAATCCTGGTGTC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008099_1045008113 5 Left 1045008099 8:97933521-97933543 CCCTCCCCCCACCCCCGCAATCC 0: 1
1: 0
2: 21
3: 210
4: 1615
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008107_1045008113 -6 Left 1045008107 8:97933532-97933554 CCCCCGCAATCCTGGTGTCGAAT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008106_1045008113 -3 Left 1045008106 8:97933529-97933551 CCACCCCCGCAATCCTGGTGTCG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008109_1045008113 -8 Left 1045008109 8:97933534-97933556 CCCGCAATCCTGGTGTCGAATAG 0: 1
1: 0
2: 1
3: 4
4: 40
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008095_1045008113 11 Left 1045008095 8:97933515-97933537 CCGCCCCCCTCCCCCCACCCCCG 0: 3
1: 135
2: 7852
3: 11939
4: 18611
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008098_1045008113 6 Left 1045008098 8:97933520-97933542 CCCCTCCCCCCACCCCCGCAATC 0: 1
1: 0
2: 25
3: 198
4: 1716
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008096_1045008113 8 Left 1045008096 8:97933518-97933540 CCCCCCTCCCCCCACCCCCGCAA 0: 2
1: 15
2: 110
3: 1784
4: 12042
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008100_1045008113 4 Left 1045008100 8:97933522-97933544 CCTCCCCCCACCCCCGCAATCCT 0: 1
1: 4
2: 28
3: 207
4: 1482
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008097_1045008113 7 Left 1045008097 8:97933519-97933541 CCCCCTCCCCCCACCCCCGCAAT 0: 1
1: 3
2: 27
3: 396
4: 3513
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data
1045008104_1045008113 -1 Left 1045008104 8:97933527-97933549 CCCCACCCCCGCAATCCTGGTGT 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1045008113 8:97933549-97933571 TCGAATAGGATATACCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr