ID: 1045008116

View in Genome Browser
Species Human (GRCh38)
Location 8:97933587-97933609
Sequence AACCATCTCTGTGTGCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045008110_1045008116 29 Left 1045008110 8:97933535-97933557 CCGCAATCCTGGTGTCGAATAGG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1045008116 8:97933587-97933609 AACCATCTCTGTGTGCTTTCTGG No data
1045008112_1045008116 22 Left 1045008112 8:97933542-97933564 CCTGGTGTCGAATAGGATATACC 0: 1
1: 0
2: 0
3: 11
4: 60
Right 1045008116 8:97933587-97933609 AACCATCTCTGTGTGCTTTCTGG No data
1045008115_1045008116 1 Left 1045008115 8:97933563-97933585 CCAATGTGGACTTGTCTGTGGAA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1045008116 8:97933587-97933609 AACCATCTCTGTGTGCTTTCTGG No data
1045008109_1045008116 30 Left 1045008109 8:97933534-97933556 CCCGCAATCCTGGTGTCGAATAG 0: 1
1: 0
2: 1
3: 4
4: 40
Right 1045008116 8:97933587-97933609 AACCATCTCTGTGTGCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045008116 Original CRISPR AACCATCTCTGTGTGCTTTC TGG Intronic
No off target data available for this crispr