ID: 1045014041

View in Genome Browser
Species Human (GRCh38)
Location 8:97983299-97983321
Sequence CACAATAGGCAAAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 7, 2: 27, 3: 63, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045014041_1045014045 30 Left 1045014041 8:97983299-97983321 CCTTCCACCTTTTGCCTATTGTG 0: 1
1: 7
2: 27
3: 63
4: 277
Right 1045014045 8:97983352-97983374 GTCCTTGCTTTCAGTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045014041 Original CRISPR CACAATAGGCAAAAGGTGGA AGG (reversed) Intronic
900354414 1:2253339-2253361 CACAGCGGGCAAAAGGTGGGAGG + Intronic
901761409 1:11474199-11474221 AACAAGAGGCCAAAGATGGAAGG + Intergenic
902266931 1:15274161-15274183 TGCAATAGGCAAAAGGCGGAAGG - Intronic
902342033 1:15790103-15790125 CACAATAGCCAAAAGGGGGAAGG + Intergenic
902805088 1:18855981-18856003 GACTATAGGGGAAAGGTGGATGG - Intronic
903940695 1:26928984-26929006 CATAACAGCCAAAAGGTGGAAGG + Intronic
904903430 1:33875789-33875811 CACATCAGCCAAGAGGTGGAGGG + Intronic
905174898 1:36129099-36129121 CACAATAGGAAAATGGAAGAGGG - Intergenic
905333143 1:37222694-37222716 CAAAATAGCCAAGAGGTGGAAGG + Intergenic
906737085 1:48140747-48140769 CAGAGTAGGAAAAAGGTTGATGG + Intergenic
908607720 1:65818399-65818421 GACAATAGGAAGAAGGAGGATGG - Intronic
908888858 1:68819666-68819688 CACAACAGACAAAACCTGGATGG + Intergenic
909165227 1:72214262-72214284 CTGAATGGGCAAAAGCTGGAAGG + Intronic
909708147 1:78611615-78611637 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
910950645 1:92644039-92644061 ACCATTAGGTAAAAGGTGGATGG + Intronic
912114670 1:106390591-106390613 CAAAACAAGCAAAAGATGGATGG + Intergenic
912538414 1:110394055-110394077 CAACAAAGGCAAAAGGAGGATGG - Intergenic
913417191 1:118621601-118621623 AAAAATAGGCAAAATGTGGCCGG - Intergenic
913491059 1:119380377-119380399 AAAAATAGGAAAAAGGTAGATGG + Intronic
917392524 1:174554242-174554264 CAAAATAGGCAAATGATAGAAGG - Intronic
917681175 1:177369461-177369483 CCAAATGGGCAAAAGCTGGAAGG - Intergenic
918054993 1:181013313-181013335 CACAACAGGAAAAAGGATGATGG - Intronic
918882049 1:190137472-190137494 CATTATAGACAAGAGGTGGAGGG + Intronic
919001040 1:191831769-191831791 CTCAAGTGGCAGAAGGTGGAAGG + Intergenic
919450867 1:197771932-197771954 CACAATATGACAAAAGTGGAGGG + Intronic
920192813 1:204204571-204204593 TACAATAGGTAAGAGATGGATGG - Intronic
921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG + Intronic
921901317 1:220454140-220454162 CATAACATCCAAAAGGTGGAAGG - Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
922399257 1:225235139-225235161 CTGAATGGGCAAAAGCTGGAGGG - Intronic
923190421 1:231615011-231615033 CTCAATAGGCAAAAGGTGAAGGG + Intronic
923366591 1:233267786-233267808 CACAGTAGCCAAAAGGTAGATGG - Intronic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
924952819 1:248900638-248900660 CTTAATGGTCAAAAGGTGGAAGG + Intergenic
1065054058 10:21825448-21825470 CACAGTAGCCAAGAGGTGGAAGG - Intronic
1065394035 10:25215085-25215107 TACAATAGCCAAAAGGGGGAAGG + Intronic
1066698385 10:38099536-38099558 CACAACAGTTAAAAGGAGGAAGG - Intronic
1066994129 10:42547610-42547632 CACAACAGTTAAAAGGAGGAAGG + Intergenic
1067757594 10:49016677-49016699 CACAAGAGTCAAGAGGTGGGAGG + Exonic
1069165421 10:65152085-65152107 CACAATGGCCCAAAGGTGGGAGG + Intergenic
1069171778 10:65240164-65240186 CACAATTGCCAAGAGGTGTAAGG + Intergenic
1069603676 10:69726230-69726252 CACAGCAGCCAAAAGGTGGAAGG - Intergenic
1070225902 10:74505232-74505254 AACCAAAAGCAAAAGGTGGAAGG - Intronic
1070234079 10:74605338-74605360 CTGAATGGGCAAAAGCTGGAAGG - Intronic
1070458653 10:76643094-76643116 CACAAAATGCAAAAGGTTTAAGG + Intergenic
1070651622 10:78241153-78241175 GACAATTGGCAAAAGTTGAATGG - Intergenic
1071295596 10:84217071-84217093 CACACTAGGAAAGAGGAGGAGGG + Exonic
1072177378 10:92941345-92941367 CACAATAGTCAAAAGGTGGAAGG - Intronic
1073197216 10:101702057-101702079 TACAATATGGAAAAGGGGGATGG + Intergenic
1073463303 10:103678836-103678858 AACAATAAGGAAAAGGTGGGAGG + Intronic
1074501465 10:114028569-114028591 CACAATAGTCAAATGGTGGAAGG + Intergenic
1077528420 11:3083136-3083158 TATAATAGCCAAAAGGTAGAAGG + Intergenic
1077702376 11:4454287-4454309 CACAATTTGCAAAGGGAGGAGGG - Intergenic
1077702676 11:4456289-4456311 CACAACAGGGAAAAGATGAAGGG + Intergenic
1078812917 11:14788247-14788269 AACAATAGGCAAAAGGGAAAAGG + Intronic
1079738294 11:24025366-24025388 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080553932 11:33398730-33398752 CACAAAAAGCAAAAGATGAAAGG - Intergenic
1081155246 11:39681827-39681849 CACAACAGGACAAAGGTAGATGG - Intergenic
1081920770 11:46773918-46773940 CTGAATGGGCAAAAGCTGGAAGG + Intronic
1085489894 11:76905473-76905495 CACAGAAGGCAAAAGGTCTAAGG - Intronic
1085794531 11:79525923-79525945 CATAAAAGCCAAAAAGTGGAAGG - Intergenic
1087196452 11:95308774-95308796 CACAATAGCCAAGAGGCAGAAGG - Intergenic
1087369466 11:97264093-97264115 CTCACATGGCAAAAGGTGGAAGG + Intergenic
1088471434 11:110191460-110191482 CTGAACAGGCAAAAGCTGGAAGG + Intronic
1089043218 11:115473997-115474019 AAAAATAGGCAAAATATGGACGG + Intronic
1090732281 11:129582159-129582181 CACAAAAGACAAGAGGTGGCAGG - Intergenic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1092325218 12:7523980-7524002 CTGAATGGGCAAAAGCTGGAAGG - Intergenic
1095823972 12:46512189-46512211 CAAAATAAACATAAGGTGGAAGG - Intergenic
1096160342 12:49371474-49371496 CACAACAGCCAAAAGGTGGAAGG - Intronic
1096380505 12:51153799-51153821 CACAACAGCCAAAAGGTGGAAGG - Intronic
1100651122 12:96590077-96590099 CACTAGAGGCATAAGGTTGAAGG + Intronic
1101057141 12:100929535-100929557 CACAATAGCCAAGATTTGGAAGG - Intronic
1102398600 12:112609488-112609510 AACAATAGGCAGGAGGTGGAAGG - Intronic
1103127868 12:118439932-118439954 CACAGTAACCAAAAGATGGAAGG + Intergenic
1105061475 12:133155293-133155315 CACAAAGGGCAAAAGGAGTAAGG - Intronic
1105412386 13:20181659-20181681 CACAACAGCCAAGAGGTGGAAGG - Intergenic
1107072495 13:36286333-36286355 CAAAAGAGGCAGAAGGTGGTTGG - Intronic
1108002719 13:45919584-45919606 CACAATAAACTAAAGGTTGAAGG - Intergenic
1108065294 13:46571429-46571451 CACAAAAAGCAATGGGTGGAAGG - Intronic
1108431292 13:50356643-50356665 CACAACAGGCATCAGGAGGAAGG + Intronic
1109991246 13:70060487-70060509 TACAATAGCCAAAATTTGGAAGG + Intronic
1110215186 13:73017339-73017361 CACAATGGCCAAGAGGTAGAAGG - Intergenic
1111919096 13:94392054-94392076 CATAATAACCAAAAGGTGAAAGG - Intronic
1115113125 14:29848252-29848274 AAAAAGATGCAAAAGGTGGATGG + Intronic
1115721489 14:36166146-36166168 CACAATAGCCATCGGGTGGATGG - Intergenic
1116035203 14:39619139-39619161 TATAATAGGAAAAAGGTGGGGGG - Intergenic
1116782825 14:49254957-49254979 CCGAATGGGCAAAAGCTGGAAGG + Intergenic
1117782342 14:59246470-59246492 CACAATAGCAGAGAGGTGGAAGG - Intronic
1117906888 14:60598607-60598629 GAAAATAGGCAAAAGGTGGCCGG - Intergenic
1118526177 14:66646519-66646541 CAGAACAGCCAAAAGGTGGAAGG + Intronic
1121960885 14:98258351-98258373 CTCACTTGGCAGAAGGTGGAGGG + Intergenic
1122502629 14:102211445-102211467 CACGATGGGCACAGGGTGGATGG - Intronic
1123022888 14:105410468-105410490 CACAATAGCGAAAATGTGGAAGG - Intronic
1124133657 15:27013330-27013352 CACAATAGCCAAGACGTAGAAGG - Intronic
1125564875 15:40669253-40669275 CACAATAGACAATATTTGGAAGG - Intergenic
1126959133 15:53970460-53970482 CACAATAGCCAAGAGGTAGAAGG - Intergenic
1128252939 15:66176380-66176402 CACAATAGCCAAGATATGGAGGG + Intronic
1128560515 15:68663286-68663308 ATCAATAGGCAAAATGTGGCTGG - Intronic
1128996199 15:72297471-72297493 TACAATAGCCAAAAGGTTGAAGG + Intronic
1129428965 15:75484331-75484353 CACAAAAGGCAAAATATGAATGG + Intronic
1131024442 15:89128378-89128400 GACAAAAGGACAAAGGTGGATGG - Intronic
1133854567 16:9537416-9537438 TACAAGAGGCAGAAGGTAGAGGG - Intergenic
1138062893 16:53910129-53910151 AACAATAGGCACAAGAGGGATGG + Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140315269 16:73890324-73890346 CAAAATAGCCAAAAGGGGTAGGG + Intergenic
1142135602 16:88450628-88450650 CACAATGGGCAGCAGGTGGGGGG + Intergenic
1143934499 17:10468682-10468704 CACAGTTGGCAAGAGCTGGAAGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1147381331 17:40057976-40057998 CACTATGGGCAGCAGGTGGATGG + Intronic
1149287731 17:55184776-55184798 AACAATAGGCAAAAATTGAAGGG + Intergenic
1149945198 17:60917887-60917909 CAAAATTGGCGAAAGGTGGCGGG - Intronic
1150671010 17:67197279-67197301 CACAATCAGCAGAAGGTGAAAGG - Intronic
1151869590 17:76827340-76827362 CACAAGGGACCAAAGGTGGATGG - Intergenic
1152006949 17:77688326-77688348 CGAAATAGCCAAAAGGTTGAAGG - Intergenic
1152276079 17:79358278-79358300 AACAACAGGCACAAGGGGGAAGG + Intronic
1152735592 17:81995471-81995493 CACAAAAGCCAAAGGGTGTAAGG - Intronic
1153932452 18:9890114-9890136 CACGATAGGCACATGATGGAAGG - Intergenic
1156821073 18:41373657-41373679 AACAATAGGAAGAGGGTGGATGG + Intergenic
1157068507 18:44379144-44379166 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
1157500518 18:48187278-48187300 CACAATAGCCAAAAGACGGAGGG + Intronic
1157696148 18:49725376-49725398 CACAATAGCCACAAGGTGGAAGG - Intergenic
1160039666 18:75334222-75334244 GACAACAGGCCAAATGTGGAAGG + Intergenic
1160169115 18:76538316-76538338 CATAATAGCCGAAAGGTGGAAGG - Intergenic
1160263183 18:77314882-77314904 CAAAATATGTTAAAGGTGGACGG + Intergenic
1162164265 19:8741797-8741819 CACAATCGCCAAAAGATGGAAGG - Intergenic
1162165337 19:8749265-8749287 CACAATCGCCAAAAGATGGAGGG - Intergenic
1162166402 19:8756721-8756743 CACAATCGCCAAAAGATGGAGGG - Intergenic
1162167468 19:8764177-8764199 CACAATCGCCAAAAGATGGAGGG - Intergenic
1162168407 19:8770475-8770497 CACAATCGCCAAAAGATGGAAGG - Intergenic
1162169476 19:8777925-8777947 CACAATCGCCAAAAGATGGAGGG - Intergenic
1162170156 19:8783239-8783261 CACAATCGCCAAAAGATGGAGGG - Intergenic
1163171402 19:15533867-15533889 CACAACATCCAAAAGGTGAATGG - Intronic
1165553798 19:36611565-36611587 CACAATAGCCAAAAGATGGAAGG - Intronic
1166680865 19:44765798-44765820 CAAAAAAGGAAAAAGGTGGGGGG + Intergenic
1166807116 19:45494110-45494132 CACAGAAGGCAAAAGGTGAGAGG - Intronic
1167575409 19:50315395-50315417 CACCTGAGGCAAAAGGTGGGGGG + Intronic
1168506063 19:56936107-56936129 CACCATAGCCCAAAGGTGGTGGG - Intergenic
925320540 2:2963228-2963250 CACATTAGGCAAGAGGGAGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925677427 2:6378961-6378983 CACAATTGCAAAAATGTGGAAGG + Intergenic
926241465 2:11090480-11090502 CATAATAGCCAAAAAGTGTAAGG + Intergenic
926514901 2:13831077-13831099 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
927533342 2:23831770-23831792 CTCAATAGGCAAAAAGTGATAGG - Intronic
928623171 2:33111727-33111749 CTCAAAAGACAAAAAGTGGATGG - Intronic
930182740 2:48380518-48380540 CACAATAGCCAAAAGGTGGAAGG + Intergenic
932365601 2:71151098-71151120 CTCACTTGGCAGAAGGTGGAAGG + Intergenic
932518990 2:72388048-72388070 CACAACTGGCAGGAGGTGGAAGG + Intronic
932687719 2:73887259-73887281 CACAATAGCCAAGAAGTGAAAGG + Intergenic
932931017 2:76038815-76038837 CACAATAGGAAAAAGGGCAAAGG + Intergenic
935081297 2:99798102-99798124 AACAATAGGAAAAAGGTGGCTGG + Intronic
935413372 2:102788739-102788761 CACACTGGGCAGAAGGGGGAGGG - Intronic
935508044 2:103931892-103931914 CACAATAATAAAAACGTGGAGGG + Intergenic
935556995 2:104520730-104520752 GACAATAGGCAAAGGATAGAGGG - Intergenic
935978122 2:108599461-108599483 CACAATAGCCAAGATTTGGAAGG - Intronic
937638335 2:124183023-124183045 ATAAATAAGCAAAAGGTGGAGGG - Intronic
937675226 2:124582846-124582868 AACACTAGGCAAAAGTTGTAAGG - Intronic
937940649 2:127283080-127283102 CTCAAAAGAAAAAAGGTGGAAGG - Intronic
938229635 2:129647346-129647368 CAGAAGAGGCAAGTGGTGGAAGG - Intergenic
939654393 2:144805393-144805415 CATACTGGGCAAAAGGTGGCAGG - Intergenic
940375610 2:152954839-152954861 GACAATAGGTAAATGGTCGATGG + Intergenic
940822298 2:158369765-158369787 CTGAATGGGCAAAAGCTGGAAGG - Intronic
941064086 2:160881208-160881230 TACAATAGGCAAAAGGGAGGGGG - Intergenic
941193781 2:162420556-162420578 CACAAAAAGCAAAAGATGCAGGG + Intronic
942674253 2:178411020-178411042 CACAATAGCCAAAAGGTGGAAGG + Intergenic
943351471 2:186801797-186801819 CTTAATAGACAAAAGCTGGAAGG - Intergenic
943400109 2:187398100-187398122 CCCAATTAGTAAAAGGTGGAAGG + Intronic
944281853 2:197907084-197907106 CCGAATGGGCAAAAGCTGGAAGG + Intronic
944455585 2:199890645-199890667 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
944524721 2:200607076-200607098 CTGAATGGGCAAAAGCTGGAAGG - Intronic
945974526 2:216259835-216259857 TCCAGTAGGCAGAAGGTGGAGGG + Intronic
946724309 2:222647145-222647167 CACAAGTGGCAAAAGGGGCAGGG + Intronic
947030292 2:225784552-225784574 CACAATATCCATAAGGAGGAAGG + Intergenic
948719254 2:239887894-239887916 TACAACAGTCAAAAGGTGGAAGG + Intergenic
949038565 2:241833501-241833523 CATAATGGCCAAAACGTGGAGGG + Intergenic
1168930828 20:1622601-1622623 CAAAAATGGCAAAAGGTGAAGGG + Intergenic
1169425590 20:5494736-5494758 CTCAGTAGTCAAATGGTGGATGG + Intergenic
1169585879 20:7084870-7084892 CACAATAACCAAAAGGTAGAAGG - Intergenic
1170763345 20:19270928-19270950 ATCAATAGGCAAAGGGTGGCAGG + Intronic
1171226484 20:23445862-23445884 CAGCAAAGGCAAAAGGTGCATGG + Intergenic
1172192070 20:33068130-33068152 CACAAAGGGCAAAAGGTGAAAGG + Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172858987 20:38032902-38032924 AACTTTAGGGAAAAGGTGGAGGG - Intronic
1173055051 20:39603942-39603964 CAGAATAGTGAAAAGGTGGATGG - Intergenic
1173235437 20:41240934-41240956 CACAATAGCCAAGATTTGGAAGG - Intronic
1173654840 20:44692803-44692825 CACAATAGCCAAAAGGTGAAAGG - Intergenic
1174032400 20:47640462-47640484 CTCAATAGGCAGCAGGTGGTTGG - Intronic
1174491256 20:50897797-50897819 GACAATAAGCAAAAGCTTGAAGG + Intronic
1174493939 20:50925557-50925579 CACAATGGGCAAAGCATGGACGG + Intronic
1174593815 20:51667753-51667775 GACAAAAGGCCAAAGGTGGCTGG + Intronic
1174925116 20:54750739-54750761 TACAATAGGCAGAAGGTGAAGGG + Intergenic
1176655716 21:9587706-9587728 CACAATAACCAAAAGGTGGAAGG - Intergenic
1177508367 21:22049026-22049048 CACACTCGGCAACAGGTGGCAGG + Intergenic
1177842580 21:26250995-26251017 CACAATATGTAAAATGTGCATGG - Intergenic
1178578762 21:33818261-33818283 CACAAGGGTGAAAAGGTGGAGGG + Exonic
1178640489 21:34341426-34341448 CACAATAGCCAAAAGTTGGAAGG + Intergenic
1178756420 21:35354398-35354420 CATAAGAGCCAAAAGATGGAAGG - Intronic
1179676141 21:42983552-42983574 CAAAATAGTCAAAAGGTAGAAGG - Intronic
1181795006 22:25301526-25301548 TACAGTGGGGAAAAGGTGGACGG + Intergenic
1181835579 22:25605191-25605213 TACAGTGGGGAAAAGGTGGACGG + Intronic
1182867422 22:33616204-33616226 CATAATAGTCAAGAAGTGGATGG + Intronic
1183757222 22:39779761-39779783 TACAAAAGTCAAAATGTGGAGGG + Intronic
1183799221 22:40147565-40147587 CCCACGTGGCAAAAGGTGGAAGG + Intronic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
949991256 3:9581101-9581123 GAAAATCTGCAAAAGGTGGATGG + Intergenic
950872095 3:16238532-16238554 CACAATAGGCCAATGATGTAAGG + Intergenic
951433453 3:22634859-22634881 CACAATAGCCAAGAGGTAGAAGG - Intergenic
951841980 3:27044167-27044189 CAAAATATGTTAAAGGTGGAGGG + Intergenic
953444379 3:42950176-42950198 CACAATAGGCAAATGGTGGTGGG + Intronic
953833052 3:46318701-46318723 CACAATAGTCAAAAGATGGGAGG - Intergenic
953839253 3:46375553-46375575 GTCAATAGGCAAAGGGGGGAAGG + Exonic
955108881 3:55928026-55928048 CACAATAGCCAAGATTTGGAAGG - Intronic
955607731 3:60723662-60723684 CAACATAGGGAAAAGGTGCATGG - Intronic
956148452 3:66216010-66216032 CTCAGGTGGCAAAAGGTGGAAGG + Intronic
960825106 3:121774503-121774525 CACAATAGCCAAAGGGTGGACGG + Intronic
961703257 3:128763733-128763755 TACCATAGGTGAAAGGTGGATGG - Intronic
962147704 3:132857735-132857757 CCCAATAGCCCAAAGTTGGAAGG + Intergenic
962147776 3:132858528-132858550 CCCAATAGCCCAAAGTTGGAAGG - Intergenic
962887785 3:139643434-139643456 CACAGTAGCCAGAAGGTGGAAGG + Intronic
963034580 3:141014493-141014515 CAGAATAGTCAAATGGTTGATGG + Intergenic
963851398 3:150214121-150214143 TGCAATAGCCAAAAAGTGGAAGG - Intergenic
966701304 3:182854840-182854862 AAAAATGGGCAAAAGGTGGAAGG + Intronic
967579105 3:191131176-191131198 CACAATGGCCAAAAGGTGGAAGG + Intergenic
970857277 4:20663539-20663561 AGGAATAGCCAAAAGGTGGAAGG + Intergenic
970989287 4:22193789-22193811 CAGAATGGGCAAAAGCTGGAAGG - Intergenic
971581979 4:28353136-28353158 GACAAAAGGCAAACTGTGGAAGG - Intergenic
972326748 4:38023733-38023755 TACAACAGTCAAAAGGGGGAAGG - Intronic
972332040 4:38073042-38073064 CACAATAGCCAAAAGGTGGAAGG - Intronic
973140152 4:46757008-46757030 CACAATAGCAAAAATATGGATGG + Intronic
973268770 4:48238468-48238490 GACAAAAGGCAAAAGTTGAAAGG + Intronic
973298884 4:48558135-48558157 CACAATAGCCAAGAGGTAGGTGG + Intronic
973646847 4:52958604-52958626 CACCATAGGCACAAGGAGAAAGG + Intronic
973762185 4:54127927-54127949 CACAATAGCCAAGATTTGGAAGG - Intronic
974899346 4:67978224-67978246 CTGAATGGGCAAAAGCTGGAAGG - Intergenic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
976485116 4:85592903-85592925 CACAATAGCCAAGAATTGGAAGG - Intronic
977496969 4:97788493-97788515 CACAATAGCCAAGATTTGGAAGG - Intronic
977693585 4:99944451-99944473 CATAATAGCCAAGAGGTGAAAGG + Intronic
978750622 4:112242540-112242562 CACTAGTGGCAAAAGGTGAAGGG + Intronic
979454520 4:120912127-120912149 ACCATTAGGCAAAAGGTTGATGG + Intronic
980223460 4:129949315-129949337 CACTATAGGTAAGAGCTGGATGG + Intergenic
980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG + Intergenic
981752492 4:148105924-148105946 CTGAATGGGCAAAAGCTGGAAGG + Intronic
982039486 4:151381776-151381798 CACAATAGCCAAAAGGTGAAAGG - Intergenic
982130428 4:152224281-152224303 TAGAGAAGGCAAAAGGTGGAGGG + Intergenic
983076293 4:163331420-163331442 CGCAATATGAAAAAGGTGGGTGG - Intronic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985219752 4:187691787-187691809 CATAATTGGCAAAAAGTGCAGGG + Intergenic
986127178 5:4893973-4893995 CACAATAAGACAAAGGTGAATGG - Intergenic
986272495 5:6245996-6246018 TACAATAGGCACAAGGGAGAAGG - Intergenic
986310820 5:6549991-6550013 CATAATAGCTAAAGGGTGGAAGG - Intergenic
987160976 5:15142108-15142130 CATAATAAGCAAAAGTTGGGTGG - Intergenic
987275565 5:16358621-16358643 CCGAATGGGCAAAAGCTGGAAGG - Intergenic
987906667 5:24087482-24087504 CAAAATTGGCCAAAGGTGTAGGG - Intronic
988741318 5:34075811-34075833 TACGATAGCCAAAAGATGGAAGG + Intronic
990291792 5:54359623-54359645 GAGCTTAGGCAAAAGGTGGAGGG + Intergenic
991531973 5:67625243-67625265 TACAATAGCCAAAAGGTGGAAGG - Intergenic
992974825 5:82104109-82104131 CATAATAGCCAAAAAATGGAAGG - Intronic
993086591 5:83370590-83370612 CAAGGTAGGCTAAAGGTGGAAGG - Intergenic
993152151 5:84174555-84174577 CCCACTAGGCAAATGGAGGATGG + Intronic
993742611 5:91559420-91559442 CTGAATAGGCAAAAACTGGAAGG + Intergenic
995367191 5:111375874-111375896 CAAAATAGGAAGAAGATGGAAGG + Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995497035 5:112757435-112757457 CAAAAAAGGCAAAAGGAGGCTGG + Intronic
996172996 5:120319049-120319071 CACAATAGCCAAGAGAGGGATGG - Intergenic
996538596 5:124605433-124605455 CACAATAGTCAGAAGGAGCAGGG - Intergenic
1001636224 5:173212279-173212301 CACAATAGCCAAAAGGTGGAAGG + Intergenic
1001688921 5:173617632-173617654 AACAATAGGCAAAAGATGAAGGG - Intergenic
1001999590 5:176190255-176190277 CATAATCGCCAAAGGGTGGAAGG + Intergenic
1002700235 5:181118943-181118965 CACTTTAGGCAAAAGGTGGAAGG + Intergenic
1002713310 5:181208466-181208488 CACGGTAGCCAAAAGGAGGAAGG - Intergenic
1003092711 6:3117933-3117955 CACAATAGCCAAAAGGGTGGAGG - Intergenic
1006969311 6:38024522-38024544 CACAATAGCCAGTAGGTGGCAGG + Intronic
1008119390 6:47593865-47593887 TACAGTAGGCAAAAGGTAGAAGG + Intronic
1008695905 6:54036807-54036829 CACAATAGCCAAGATATGGAAGG + Intronic
1008930967 6:56939446-56939468 TACAATATGCACAAGGAGGAAGG + Intronic
1010117163 6:72327438-72327460 CGCAAAAGTCAAAAAGTGGATGG - Intronic
1011571646 6:88743734-88743756 CACAATAGCTAAAATGTGGAAGG - Intronic
1012592294 6:100997097-100997119 CACAGTATGCAAAATATGGAAGG + Intergenic
1013176750 6:107684317-107684339 CCCACTAGTCTAAAGGTGGAGGG + Intergenic
1014058087 6:117039914-117039936 CTGAATGGGCAAAAGCTGGAAGG - Intergenic
1014135846 6:117888676-117888698 CACAATAGCCAAGGGGTGGAAGG + Intergenic
1014328533 6:120029921-120029943 CACAATAGCCAAGATTTGGAAGG + Intergenic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018292650 6:162308610-162308632 CACAAATGGCAAAAGTTGGGAGG - Intronic
1018547353 6:164952345-164952367 CAGAAGTGGCAGAAGGTGGAAGG - Intergenic
1018668473 6:166160958-166160980 CAGAATAGGCTAAGGGGGGAAGG + Exonic
1018673247 6:166197052-166197074 AAAAGGAGGCAAAAGGTGGAAGG - Intergenic
1019691976 7:2420443-2420465 CACAATAGCCAAAAGGTGGAAGG - Intronic
1020346407 7:7169034-7169056 GAAAATAGGTTAAAGGTGGAGGG - Intronic
1021377454 7:19925354-19925376 CAGAAGAGGGAAAAAGTGGATGG + Intergenic
1023155133 7:37242957-37242979 CAAAACAGGCAGAAGGTAGAGGG - Intronic
1023402698 7:39801938-39801960 CACAATAGCCAAAAGGGGGAAGG + Intergenic
1023898022 7:44451056-44451078 TACAATAGCTGAAAGGTGGAAGG + Intronic
1024646924 7:51378694-51378716 CACAATAGTCAAAAGGGGGAAGG - Intergenic
1025792027 7:64697536-64697558 CACAAAAGCCAAAAGGCTGAAGG - Intronic
1025934321 7:66022597-66022619 CACCATAGCCAAAAGGTGGAAGG + Intergenic
1026329595 7:69340152-69340174 CCCAACAGGCAAAAGCTGCAGGG - Intergenic
1027335115 7:77142113-77142135 CTGAATGGGCAAAAGCTGGAAGG + Intronic
1027624994 7:80533663-80533685 CTCACTTGGCAGAAGGTGGAAGG - Intronic
1028309403 7:89311959-89311981 CACAATAGCTAAAAGATGAAAGG + Intronic
1030570459 7:111215506-111215528 CATAACAGGCAAAACATGGAAGG + Intronic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1031688948 7:124765162-124765184 CACAAGATGCCAAAGGAGGAAGG - Exonic
1031719593 7:125155327-125155349 TACAATGGGCAAGAGGTGGAAGG - Intergenic
1031837311 7:126693025-126693047 CTCAATAGGAAAAAGTTGGCTGG + Intronic
1032682771 7:134202561-134202583 CACAATAGCCAAAAGGTGGAAGG + Intronic
1033723298 7:144084785-144084807 CAAAATATGCTAACGGTGGAGGG + Intergenic
1035985839 8:4430852-4430874 CACAGAAGGCAAAGAGTGGAGGG - Intronic
1037222711 8:16544692-16544714 CACAATATGCAAGAGGTAGAAGG + Intronic
1037315314 8:17594888-17594910 CACAACAGCCAGAAGGTGGAAGG - Intronic
1037726820 8:21489553-21489575 CACAATAGTCAAAAACTGGAAGG + Intergenic
1039708028 8:40027034-40027056 CACAATAAGCACAAGAAGGACGG + Intergenic
1041054976 8:53975463-53975485 CACAATAGCTAAAAAGTAGAAGG + Intronic
1041101946 8:54404947-54404969 TACAATAGCCAAACAGTGGAAGG + Intergenic
1041607464 8:59799597-59799619 CAAAATATGCTAATGGTGGAGGG - Intergenic
1041861430 8:62517723-62517745 CACAATATGCTAATGCTGGAAGG - Intronic
1041873379 8:62660613-62660635 CACTAAAGGCAAAAGGTGATAGG + Intronic
1043980823 8:86637024-86637046 CGCAATAGCCAAAACATGGAAGG - Intronic
1044174279 8:89098331-89098353 TACAAAAGGCAAAAGGTAGTAGG + Intergenic
1044252983 8:90025816-90025838 CTGAATAGGCAAAAACTGGAAGG - Intronic
1044312151 8:90706286-90706308 CTGAATAGGCAAAAGGTAGAAGG - Intronic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1045132684 8:99174242-99174264 CACAATAGCTAAAAGGTGAGAGG - Intronic
1045429534 8:102100623-102100645 CACATTAGCCAATAGGTGGAAGG + Intronic
1047283795 8:123468624-123468646 CACAATAGCCAAGAGGTGGATGG - Intergenic
1047580547 8:126210190-126210212 CTGAATGGGCAAAAGATGGAAGG - Intergenic
1049348392 8:142151222-142151244 AACAATGGGCAAAGGATGGATGG + Intergenic
1049527843 8:143137732-143137754 CATAACAGCCAAGAGGTGGAAGG - Intergenic
1049788823 8:144463676-144463698 GACAATAGTCAAAAGGAGGCCGG + Intronic
1049979898 9:894369-894391 CACAATATGCAAAATGTGTAAGG + Intronic
1050018180 9:1257836-1257858 CACAATAGCCAAAATATGGATGG + Intergenic
1050404075 9:5289069-5289091 CTGAATAGGCAAAAGCTGGAAGG - Intergenic
1050425660 9:5510098-5510120 CTGAATAGGCAAAAGCTGGAAGG + Intergenic
1051463641 9:17352979-17353001 CAGAGTAGCCAAAATGTGGAAGG - Intronic
1051645063 9:19259880-19259902 CACAATAGCCAAGATTTGGAAGG - Intronic
1053119871 9:35538531-35538553 CACAATGGGCAAAAAGAGGAGGG + Intronic
1053529649 9:38867453-38867475 CCCAGTAGCCAAAAGGTGGAAGG + Intergenic
1054201874 9:62091880-62091902 CCCAGTAGCCAAAAGGTGGAAGG + Intergenic
1054636483 9:67496479-67496501 CCCAGTAGCCAAAAGGTGGAAGG - Intergenic
1055582801 9:77725627-77725649 CACAATGGGCACATGCTGGAAGG + Intronic
1055587028 9:77765803-77765825 CACGACAGCCAAAAGGTGGAAGG + Intronic
1056285563 9:85084122-85084144 GACAAAAGGCAACAGATGGAAGG - Intergenic
1056952627 9:91055772-91055794 TACAATATGAAAAAGGTGGAGGG - Intergenic
1057358331 9:94350523-94350545 CACAATAGCCAAAAGGTAGAAGG - Intergenic
1057649418 9:96907087-96907109 CACAATAGCCAAAAGGTAGAAGG + Intronic
1057688834 9:97264494-97264516 CACAATAGCCAAAATGTGGAAGG + Intergenic
1058646566 9:107136418-107136440 CAGAATAGACTAAAGGTGGAGGG - Intergenic
1061856883 9:133446594-133446616 CACAATAGCCAAAGTGTGGAAGG - Intronic
1062728497 9:138093993-138094015 CACAATAGCCAAAAGGAGAAAGG + Intronic
1185871089 X:3665573-3665595 CACTACAGCCAAGAGGTGGAAGG + Intronic
1185883469 X:3760793-3760815 CACAATAGCCAAAAGATGGAAGG - Intergenic
1187240507 X:17508812-17508834 CACAATAGCCAAAAGGTAGAAGG - Intronic
1188290881 X:28387231-28387253 CACAATAGCCATGAGGTCGAAGG + Intergenic
1188592101 X:31850152-31850174 CAAAATAGCCAAATGGTAGAAGG - Intronic
1189307064 X:39994802-39994824 CACAATAATAAAAAGGGGGAGGG + Intergenic
1189390763 X:40574538-40574560 CACAATAGCAAAAAGGTGGAGGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190484234 X:50909055-50909077 CACAATAGGCAAAATTTAGATGG - Intergenic
1190690730 X:52910994-52911016 CTCACGTGGCAAAAGGTGGAAGG + Intergenic
1190695253 X:52944798-52944820 CTCACGTGGCAAAAGGTGGAAGG - Intronic
1191739642 X:64423182-64423204 CACCATGGGCTAATGGTGGATGG - Intergenic
1191969994 X:66802938-66802960 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
1192672398 X:73159295-73159317 CAAAATATGTTAAAGGTGGAGGG + Intergenic
1192845275 X:74900724-74900746 CACAATAGCCAAAAGGTGAAAGG + Intronic
1193065943 X:77260143-77260165 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
1195548772 X:106142658-106142680 TTCAATGGGCAAAAGCTGGAAGG + Intergenic
1196202952 X:112906670-112906692 CAGAATTGCCAAAAGTTGGAAGG + Intergenic
1196538742 X:116880547-116880569 AACAAAAGGCAAAAAGTGGAGGG - Intergenic
1199347174 X:146755250-146755272 CACAAAATGCCAAAGCTGGAAGG + Intergenic
1200371687 X:155732722-155732744 CACAATAGTCAAGATTTGGAAGG + Intergenic
1200792966 Y:7315709-7315731 CACTACAGCCAAGAGGTGGAAGG - Intergenic
1202186913 Y:22195291-22195313 CACAATAGCCAAGATTTGGAAGG + Intergenic
1202204447 Y:22391105-22391127 CACAATAGCCAAGATTTGGAAGG - Intronic