ID: 1045014979

View in Genome Browser
Species Human (GRCh38)
Location 8:97993362-97993384
Sequence TTGAAATAAATGACCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045014979_1045014981 13 Left 1045014979 8:97993362-97993384 CCATCAGTGGTCATTTATTTCAA 0: 1
1: 0
2: 2
3: 24
4: 268
Right 1045014981 8:97993398-97993420 ATGTGTCCAAGTTCCACTATGGG No data
1045014979_1045014980 12 Left 1045014979 8:97993362-97993384 CCATCAGTGGTCATTTATTTCAA 0: 1
1: 0
2: 2
3: 24
4: 268
Right 1045014980 8:97993397-97993419 AATGTGTCCAAGTTCCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045014979 Original CRISPR TTGAAATAAATGACCACTGA TGG (reversed) Intronic
901161435 1:7179089-7179111 TTGGAAGCAATGACCACAGAGGG - Intronic
903487904 1:23705174-23705196 GTGGATTAAATGACCTCTGAGGG - Intergenic
903675809 1:25063868-25063890 ATTAAACAAATGACCACTGCGGG + Intergenic
904099792 1:28015291-28015313 TTGAAACAAAGGACCTCTGTAGG + Intronic
904933500 1:34109285-34109307 TTGAATTGTATGAGCACTGATGG + Intronic
905798157 1:40827006-40827028 TTGAACTAGAGGACCTCTGAGGG + Intronic
907742036 1:57176137-57176159 ATGTCATAAAGGACCACTGAGGG - Intronic
908371145 1:63479042-63479064 TTGAATAAAATTTCCACTGAAGG + Intronic
908494065 1:64677226-64677248 TTGAAATAAAAGACTTGTGAGGG + Intronic
909253510 1:73388741-73388763 TTGGAGTAAATGACAACAGAAGG + Intergenic
910064157 1:83132962-83132984 TTGAAACATATAACCATTGAGGG - Intergenic
914955892 1:152161894-152161916 TTGAAATAAAACACCTTTGAAGG + Intergenic
915272361 1:154763082-154763104 TTGAAAGAGAAGACCATTGAGGG - Intronic
917291357 1:173475403-173475425 TTGAATTAGCTGTCCACTGAAGG - Intergenic
917882180 1:179348002-179348024 TTCAAATGAATGAACACTCAGGG - Intronic
917894711 1:179476474-179476496 CTGAAAGCAATGACCACAGATGG - Intronic
919515769 1:198520973-198520995 TTGAAATAAATGATCTCTGTAGG - Intergenic
920865944 1:209753933-209753955 TTGAAATAAATAACAAAAGATGG - Intergenic
920959641 1:210653033-210653055 TAGACATAAATGTCCACTGGAGG + Intronic
921296556 1:213709640-213709662 TAGCAATAAATGCCCACTGGAGG - Intergenic
921921227 1:220672422-220672444 TTGAAAAAATTGTCCACTGTGGG - Intergenic
922147743 1:222964999-222965021 TTGAAAAAAAAAACTACTGAAGG - Intronic
924583536 1:245342245-245342267 TTGAAATAAAAACTCACTGAAGG - Intronic
1063422944 10:5928101-5928123 AAGAAATACATGACCACTGCTGG - Intronic
1063737101 10:8770415-8770437 TTGAAATAAATTACAATTGATGG - Intergenic
1064508920 10:16067541-16067563 TTGAACTAATCTACCACTGATGG + Intergenic
1065588664 10:27243392-27243414 CTTAAATAAATGACCCCTGCTGG - Intergenic
1067257127 10:44652310-44652332 TTGAAATCAATGACATCTCATGG - Intergenic
1068509921 10:57952531-57952553 TTGCTATAGATGACCACTCAGGG - Intergenic
1069117304 10:64523621-64523643 TTGAAGCAAATCAACACTGAAGG + Intergenic
1070223451 10:74475169-74475191 TTGATATAAATGACAATTAAGGG - Intronic
1071906140 10:90175756-90175778 TTGAAATAAATTACTAGTGAAGG - Intergenic
1072518033 10:96205736-96205758 TTGAAATAAATAACAAAGGAGGG + Intronic
1074150544 10:110755834-110755856 TTAAAAAAAATGACCACCAAGGG + Intronic
1074292921 10:112154423-112154445 TTCAAATAAATCTACACTGATGG + Intronic
1075854857 10:125621027-125621049 TAGAAATAAGTGTCCATTGATGG - Intronic
1077978045 11:7270480-7270502 TTTAGAAAAATGACCACTAATGG - Intronic
1079944269 11:26722032-26722054 CTGAAATTAATAACCACTGGGGG + Intronic
1081440803 11:43078636-43078658 GTGGACTAAATGACCACTAAAGG + Intergenic
1082868324 11:57920012-57920034 ATGAAATAAATGAAAACGGATGG + Intergenic
1085865709 11:80289590-80289612 TTGAAATAAAACAAGACTGAAGG - Intergenic
1086578492 11:88368764-88368786 TAGAAAAAAATGACCAGGGATGG + Intergenic
1086965405 11:93021977-93021999 ATGAAATAAATGTAAACTGAAGG + Intergenic
1088170841 11:106994748-106994770 GTGAAATAAATTACCAATGGAGG - Intronic
1088268737 11:108012246-108012268 ATGAAAAAAATGAGCACTAAGGG - Intronic
1090080337 11:123608323-123608345 TTCAAATAAATGACTACTTCTGG - Intronic
1090550579 11:127815429-127815451 TTGAATTGAATGACCCCTGTGGG + Intergenic
1092288435 12:7143442-7143464 TGGAGACAATTGACCACTGAAGG + Intronic
1093078810 12:14786186-14786208 CTGGAATAAGTAACCACTGAAGG + Exonic
1093226579 12:16491301-16491323 TGGAAATAAATGATCTCTGCAGG + Intronic
1095652012 12:44622351-44622373 TTGAAATAAATGTCAATGGATGG - Intronic
1098952618 12:76657395-76657417 TAAACATAAAAGACCACTGAAGG - Intergenic
1099344951 12:81487836-81487858 TTAATATAAATGACCATAGAAGG + Intronic
1099372785 12:81858356-81858378 CTGAAATGACTGATCACTGAAGG - Intergenic
1099936021 12:89126450-89126472 TTGCAATAAAGTACCACTTAGGG + Intergenic
1101584133 12:106069857-106069879 TTAACAAAAATGACCAATGATGG + Intronic
1102593103 12:113972373-113972395 ATGAATTAAATGACAACTGGGGG + Intergenic
1102728127 12:115083907-115083929 TTAAAACAGATGACCACTCAAGG + Intergenic
1104514104 12:129407913-129407935 TTAAGGTAAATGACCACAGATGG + Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108413470 13:50173673-50173695 TTGAAATATATGTCCTCGGATGG - Intronic
1109865914 13:68262315-68262337 TTCAAATAAAAGACCAATAATGG + Intergenic
1110531247 13:76601626-76601648 TTTTAAGAAATGACAACTGATGG - Intergenic
1111298638 13:86317308-86317330 TTGAAGTAAATAGCCTCTGAGGG + Intergenic
1112279755 13:98052216-98052238 TCAAATTAAATGAGCACTGACGG - Intergenic
1112876313 13:104044081-104044103 TTAAAATAAATGACTAAAGAAGG + Intergenic
1115252134 14:31360226-31360248 TTCAAATAAATTACCAGTGAGGG - Intronic
1116055622 14:39860930-39860952 TTTACATACATGACCTCTGATGG - Intergenic
1117653840 14:57933980-57934002 TTGATATAAATGAAGACCGATGG - Intronic
1118867744 14:69716784-69716806 TTGAAACAAATGACTACTGAGGG - Intergenic
1119001842 14:70889373-70889395 TTGGAGTAAATGACCTCTAAGGG + Intergenic
1119995668 14:79251132-79251154 GTGAAATAAGTAGCCACTGAAGG + Intronic
1120104922 14:80482931-80482953 TTAAAATAAAGGATCACTGGTGG + Intronic
1120220385 14:81725344-81725366 TCTAATTCAATGACCACTGATGG - Intergenic
1123104380 14:105831427-105831449 TTGAAACAATTTCCCACTGATGG + Intergenic
1126473464 15:49041836-49041858 ATAAAATAAATGTCCTCTGAAGG + Intronic
1126743067 15:51797676-51797698 TGGAACAAAATCACCACTGAGGG - Intronic
1127921639 15:63499203-63499225 TTGAACTAAATGACCATTGAGGG - Intergenic
1128102131 15:65011020-65011042 TTGAAACAAATGTCTACTCAGGG + Intronic
1129207384 15:74045110-74045132 CTGAACCAAATGACAACTGAGGG - Exonic
1129519559 15:76177206-76177228 CTGAAATAGATGCCCCCTGAAGG + Intronic
1129637568 15:77337343-77337365 TTAAAATAAATATTCACTGATGG - Intronic
1129956615 15:79642979-79643001 TTAAAATAAATGACAACATAGGG + Intergenic
1130606539 15:85322268-85322290 GTGAAATAAATGACCTTAGAAGG + Intergenic
1131963832 15:97816545-97816567 TAGAAATAAATGACTGCTTATGG - Intergenic
1133659289 16:7900533-7900555 TGGAAATAAGTGAGCAGTGAGGG - Intergenic
1134404456 16:13943651-13943673 TTGAAATTAATTAACATTGATGG + Intronic
1135842213 16:25887151-25887173 GTGAAAGGAATGTCCACTGAAGG + Intronic
1137856633 16:51801174-51801196 TAGAAATAAAGGCCCAGTGAAGG + Intergenic
1138813303 16:60175832-60175854 TTGAAAGAAAAGATCAATGAAGG + Intergenic
1138852860 16:60651087-60651109 TTGAAATAAAAGAAAATTGATGG + Intergenic
1139067262 16:63333058-63333080 TTTAAGTAAATGAACACTAATGG + Intergenic
1143301426 17:5913450-5913472 TTAAAACAAATGGCCACTGTGGG + Intronic
1145334038 17:21897239-21897261 TTGAAAGAAATGATCTCGGATGG + Intergenic
1145748211 17:27336217-27336239 TTGAAAAAAATGGCCAGCGAAGG + Intergenic
1145927175 17:28656912-28656934 TTATAATAATTGACCACTTATGG - Intronic
1147003941 17:37386651-37386673 TGGAGATAAATGATCATTGATGG - Intronic
1148137606 17:45304711-45304733 TTGGAAGAAATTACCTCTGAGGG - Intronic
1149011851 17:51865065-51865087 TTGAATTAAAGGACCTCAGAGGG - Intronic
1150927681 17:69550830-69550852 TTGGATTAAATGACCACTTTAGG + Intergenic
1151505453 17:74524245-74524267 CTGAAATAAAAGATCACTGTTGG - Intronic
1153236728 18:2995489-2995511 TTTAAATCAATCACCTCTGAAGG + Intronic
1153302443 18:3603072-3603094 TTGAAATGAATTACCAATAAAGG + Intronic
1153423187 18:4931764-4931786 TGGAAATAAATGAGCACTTATGG + Intergenic
1154324901 18:13382942-13382964 TTTAAGTCAATGACCTCTGAAGG + Intronic
1156064948 18:33129188-33129210 TTGAATTAAATGAGCAGTTAAGG - Intronic
1156424036 18:36989292-36989314 TTAAAGCAAATGAACACTGATGG - Intronic
1156760877 18:40588583-40588605 TTGAAAGAAAAAAACACTGATGG + Intergenic
1157913475 18:51641118-51641140 ATGAAATTAATCAACACTGATGG - Intergenic
1158848630 18:61471399-61471421 TTGAAATAAATGACTTTTGCTGG - Intronic
1159103346 18:63979154-63979176 TTGAAAGAAACAACCACAGAAGG - Intronic
1162669569 19:12243957-12243979 TTGAAAAAAATGTCCACTCAGGG + Intronic
1163079471 19:14926820-14926842 TTTAAATAAATGACCATTTGGGG + Intergenic
1165982824 19:39739005-39739027 TTGTAAGAAATTACCACAGAAGG + Intergenic
1168179072 19:54647721-54647743 ATGACATAAATGCCCATTGATGG - Intronic
927360925 2:22232298-22232320 ATTAAACAAATGACCCCTGAGGG + Intergenic
927428944 2:23010076-23010098 TTGTGCTTAATGACCACTGATGG - Intergenic
930046718 2:47178815-47178837 TTGAAAGAAAAGATCATTGATGG - Intergenic
930413430 2:51056822-51056844 TTATTATAAATGACCACTAAAGG - Intergenic
930595112 2:53378009-53378031 TTGAAACAATTGACAACTTAAGG + Intergenic
930946122 2:57078099-57078121 TTAAAATAATTGTCCCCTGAAGG + Intergenic
931057026 2:58483675-58483697 TTTAAATAAATGACTGCTGTAGG + Intergenic
932887885 2:75563349-75563371 TTGAGATAAATGACTACTTAAGG + Intronic
936385028 2:112021634-112021656 TTGAAAGAAATGACCTCAGCTGG + Intronic
936892558 2:117389493-117389515 ATGACATGATTGACCACTGAGGG + Intergenic
937452211 2:122010963-122010985 TTAAAATGAATGAGCACAGAAGG - Intergenic
937598464 2:123698848-123698870 ATGAAATAAATGAGAAGTGAGGG + Intergenic
938607826 2:132914668-132914690 CTGAATTCTATGACCACTGAAGG + Intronic
939553686 2:143647691-143647713 TTGAGATAAAAGAGCTCTGACGG - Intronic
940065844 2:149627862-149627884 ATGGAATAAATGGCCATTGAGGG + Intergenic
940269838 2:151878415-151878437 TTGAAATAAATGTAAATTGAGGG + Intronic
940535756 2:154941527-154941549 TTGATATACCTGAACACTGATGG + Intergenic
940794982 2:158068482-158068504 TTGAGAAAAATCACCACTAAAGG + Intronic
940824242 2:158392466-158392488 TTCAAAAAAATGTCCACTGGAGG + Intronic
943135121 2:183900485-183900507 TTAAAACAAATTACCACTGGAGG + Intergenic
943370951 2:187015024-187015046 CTGTAATAAAGGACCACAGACGG + Intergenic
943502862 2:188713460-188713482 TAGAAAAAAACAACCACTGATGG + Intergenic
945071953 2:205999748-205999770 TTGTAATAAAATACCAGTGAAGG - Exonic
945883053 2:215346455-215346477 TTAAAATAAATGACCAATGCTGG - Intronic
946844617 2:223848366-223848388 TTGAAATTAATCACCAGGGAAGG + Intergenic
947023601 2:225711767-225711789 GTGAAATAAATGTGCACAGATGG - Intergenic
948841913 2:240655411-240655433 TTCAAATTAATGACCTCTGTGGG - Intergenic
1168734577 20:119850-119872 TTTAAAAAAATGACCACACATGG - Intergenic
1168962893 20:1881044-1881066 TTGCACCAAATGACCTCTGAGGG + Intergenic
1173402295 20:42736445-42736467 ATGCAACAAATGTCCACTGAGGG + Intronic
1174800787 20:53561529-53561551 TGGAACTAACTGACCAATGATGG - Intergenic
1176970283 21:15257072-15257094 TTAAAAAAAAAGACCACTGAAGG + Intergenic
1179349702 21:40596419-40596441 TTGACAAAAATGGCCATTGAGGG - Intronic
949637156 3:5995669-5995691 TTGAAATAAATGTCCACCTTTGG + Intergenic
951369777 3:21831100-21831122 TTGAAACAAATCAACACTCAAGG + Intronic
955307827 3:57851861-57851883 TTGAAACAAAAGACAACTGAAGG - Intronic
955576067 3:60364495-60364517 GTAAAACAAATGATCACTGAAGG + Intronic
955780289 3:62477418-62477440 TAGAAATAAAATTCCACTGAGGG - Intronic
957946678 3:87071985-87072007 ATGAATTAAAGGACCATTGATGG - Intergenic
959138310 3:102453077-102453099 ATGATAAAAATGACCACTGCTGG - Exonic
959942531 3:112094740-112094762 TTGAAATGATTGTCCACTGGAGG - Intronic
960008767 3:112810493-112810515 GAGAAATATATGACCACTAAAGG - Intronic
960132320 3:114070441-114070463 TTGTCTTATATGACCACTGAAGG + Intronic
963171855 3:142259266-142259288 TTGAACTAAGTGACTACAGATGG + Intergenic
963590739 3:147255134-147255156 ATGAAAAAAATGTCCACTTACGG + Intergenic
964171206 3:153771589-153771611 TTGAAATAATTGAAAACAGACGG + Intergenic
966350290 3:179026768-179026790 TTCAAGTAAATGACCTCTGCTGG + Intronic
969352444 4:6605549-6605571 TAGAAAAAAATGAGCACTGAGGG + Intronic
969903368 4:10370611-10370633 TTGAAATATATTCCCATTGAAGG - Intergenic
970614727 4:17758333-17758355 ATTGAATAAATGATCACTGATGG - Intronic
971656935 4:29360156-29360178 TTGATATTAATGTCCACTAAGGG + Intergenic
971800525 4:31284604-31284626 TTGAAATAGAAGATCAGTGAAGG - Intergenic
972731672 4:41801026-41801048 TTGACATAAATGATCACTCTGGG - Intergenic
972963440 4:44481581-44481603 TTATCACAAATGACCACTGAAGG + Intergenic
974446135 4:61984600-61984622 TTGACATAAAACACCACTGATGG - Intronic
974557708 4:63472963-63472985 TTGAAATAATTGACTATTGTGGG + Intergenic
974582155 4:63816745-63816767 TTGTAATAAATGTCCAATGTGGG - Intergenic
974662883 4:64917547-64917569 TTGGAATTGATGACCACAGATGG + Intergenic
975962443 4:79929147-79929169 TGGAAATAGATGACCACTACTGG + Intronic
976675907 4:87703221-87703243 TTGAAATTTAGGACTACTGAAGG - Intergenic
978038899 4:104033479-104033501 TTAAAAGAAATGACCACTAAAGG - Intergenic
978789557 4:112646386-112646408 ATGAAAAAATTGACTACTGATGG + Exonic
978837964 4:113176130-113176152 TTGACACAAAGGACCAATGATGG - Intronic
979929991 4:126617894-126617916 TAGCAATAACTGCCCACTGAAGG - Intergenic
979972191 4:127149147-127149169 ATGATATAAATGTCCAATGAAGG - Intergenic
981874558 4:149525835-149525857 GTAAAATAAATGACAAGTGAAGG + Intergenic
982353602 4:154443324-154443346 ATAAAATAAATTACCACTCAAGG + Intronic
982565254 4:156977668-156977690 TTGAAATAACTGCCCACAGATGG - Intergenic
983353727 4:166629130-166629152 TTGAAATCAATGTTCACTGTGGG - Intergenic
983884548 4:172965681-172965703 TTGAATTAAATTGCCACTGTTGG - Intronic
986500312 5:8391543-8391565 TTCAAATAATTAACCACTGGAGG + Intergenic
986579436 5:9249649-9249671 TTGATATAAAAGACCTCTTAAGG + Intronic
986681646 5:10238542-10238564 TATAAATAAAAGGCCACTGATGG - Intronic
987378536 5:17261074-17261096 TTTAGATAAATGACCAAAGATGG + Intronic
988037484 5:25846451-25846473 TTAACATAAGTGGCCACTGAGGG + Intergenic
988346720 5:30046480-30046502 TTGAAAAACATGACTATTGAGGG - Intergenic
989454626 5:41628793-41628815 TTGAAATAGAGGACCACGGAAGG + Intergenic
990333789 5:54752695-54752717 TTAGAATAAATGGCCACTCAGGG - Intergenic
992065145 5:73100080-73100102 TTGAAATAACTGACCACCTTTGG - Intergenic
992548536 5:77839662-77839684 AAGAAATCCATGACCACTGAAGG + Intronic
992719151 5:79542657-79542679 TGGAAGTATATGATCACTGATGG - Intergenic
992767550 5:80015203-80015225 TTGAAATAAATATCCAGTTAGGG + Intronic
994248006 5:97502903-97502925 TTGAAATAAATGACAACCATAGG + Intergenic
994506479 5:100648827-100648849 CTGATATAGATGACAACTGAAGG + Intergenic
994635179 5:102337558-102337580 TTGATATAAATTACCATTGAAGG - Intergenic
995013045 5:107278994-107279016 TGGAATTAAATGCCCATTGATGG - Intergenic
995895979 5:117010969-117010991 TAGAAAGAAATGACCACTACTGG - Intergenic
996337923 5:122404984-122405006 TTGAAATAAAAAACAAGTGAAGG - Intronic
996391085 5:122962870-122962892 TTGAACTTAATGACTGCTGAAGG - Intronic
996923518 5:128796376-128796398 TTGAAATAAAAGATAATTGAAGG + Intronic
997752576 5:136361415-136361437 TTGATAAAAATAACAACTGAAGG - Intronic
1001332974 5:170775183-170775205 TTCAGAAAAATAACCACTGAAGG + Intronic
1003230520 6:4248398-4248420 TAGAATAAAATGACCACAGATGG - Intergenic
1003958001 6:11183621-11183643 TGGAAATAAATGATCATAGAAGG - Exonic
1004321099 6:14632336-14632358 TAGAAATATATGACCACTCTAGG - Intergenic
1004418479 6:15446673-15446695 TTAAAATGAATGACCATTTACGG - Intronic
1004599808 6:17137765-17137787 TTGACAAAAATAACCAATGAGGG + Intergenic
1005048134 6:21661428-21661450 TCACACTAAATGACCACTGAGGG + Intergenic
1005155672 6:22803460-22803482 ATGAAATAAATGACCTCTCTTGG + Intergenic
1007044846 6:38762660-38762682 TTGAAAGAAATGGCCACAGCAGG + Intronic
1007411696 6:41666845-41666867 TGGAGATAAACGACCACTGCTGG - Intergenic
1008815508 6:55559755-55559777 TTAAATTAAATGACCTCTCAGGG + Intronic
1009658705 6:66580923-66580945 TTGAAATAATTGCTCACTAATGG - Intergenic
1009678793 6:66863663-66863685 TTGATAGAATTAACCACTGAAGG - Intergenic
1009767410 6:68098477-68098499 TTGAAATAATTCACCATTGAGGG - Intergenic
1012198364 6:96373900-96373922 TCTAAATAAATGAACTCTGAGGG + Intergenic
1012817155 6:104038572-104038594 TTGAAATACATAATCACTTAGGG - Intergenic
1014745907 6:125200434-125200456 TGCAGATAAATGACTACTGAGGG - Intronic
1018875012 6:167814594-167814616 TTGAAGTAAATGACCATTTTTGG - Intergenic
1020420009 7:7992251-7992273 ATGAAATAAATGACCATAGAAGG - Intronic
1020421247 7:8007899-8007921 TTCAAATCAAGGCCCACTGAGGG + Intronic
1021207664 7:17805132-17805154 TTGAAAAACATGACCACTGGTGG + Intronic
1021324673 7:19252198-19252220 TTGAAATACCTGATCACAGAGGG - Intergenic
1021774204 7:24035981-24036003 TAGCAATGAATGACCAGTGAGGG + Intergenic
1022092801 7:27118436-27118458 TTGAAATAGGGAACCACTGAAGG + Intronic
1022239651 7:28497792-28497814 TTGAGAAAAATAAACACTGAAGG - Intronic
1022262819 7:28722968-28722990 TTGAACTAAATGACCCTTAAAGG - Intronic
1022312672 7:29211853-29211875 TTGTAATAAAAGCCCACTGTAGG - Intronic
1022742009 7:33130899-33130921 TTGATAGAAATGCTCACTGAAGG + Intronic
1023422005 7:39990552-39990574 TGGAAATAAATGGGCGCTGAAGG + Intronic
1023704464 7:42926840-42926862 TAGTACTAAATGACCAGTGAGGG - Intronic
1023749709 7:43360603-43360625 TTTAAATCAATGACCTCTAATGG + Intronic
1023950687 7:44841801-44841823 TTGAAATAATGGAGCAGTGAAGG - Intronic
1024769732 7:52706748-52706770 TTGAAATGAATGACATCTTATGG + Intergenic
1024911811 7:54455305-54455327 TTGACATAAATGAACATGGATGG + Intergenic
1026049592 7:66933853-66933875 AAGAAAGAAATGACCACTGCTGG - Intronic
1026143005 7:67722307-67722329 GAGAAATAAATGACGAATGAAGG + Intergenic
1028594090 7:92529246-92529268 TGGAAAAAAATGTCGACTGAAGG + Intronic
1031778184 7:125927689-125927711 TTGAAGTCAATGATCCCTGAGGG - Intergenic
1031961838 7:127996906-127996928 TTGAAATTAAAGACCACTGGTGG - Intronic
1033180866 7:139176732-139176754 TTGAACTAAATAACCAGTGCTGG - Intronic
1034701521 7:153100161-153100183 TTGAAGTTTATGACCACTGAAGG + Intergenic
1034955883 7:155334407-155334429 CTGAGATCAATGACGACTGAGGG - Intergenic
1034956097 7:155335958-155335980 TTGAGATCAATGAGGACTGACGG - Intergenic
1035776648 8:2192535-2192557 GTGGAATAAAAGACCACTTAAGG + Intergenic
1035958608 8:4112076-4112098 TTGAAATAAAAGGAAACTGAAGG + Intronic
1036623890 8:10448951-10448973 TTGAAGCAAATGAGAACTGAGGG + Intergenic
1036928413 8:12929942-12929964 TCGTAATAAATGAGAACTGAAGG + Intergenic
1037037648 8:14187680-14187702 ATGAAAAAAATGACAACTGCAGG + Intronic
1037167203 8:15845641-15845663 TGCAAATAAATGACAACTCAGGG - Intergenic
1037839751 8:22235738-22235760 TTAAAATAGATGACCAGTGAAGG - Intergenic
1038056213 8:23860274-23860296 AAGAAATAAATGCACACTGATGG - Intergenic
1039172465 8:34763346-34763368 TTGAATAAAATGTCCATTGAAGG - Intergenic
1040074584 8:43216249-43216271 TTGAAAACAATGACCACTTTTGG + Intergenic
1042354069 8:67806750-67806772 TTGAACAAAATGACTCCTGAGGG - Intergenic
1042738059 8:72011085-72011107 TTGAATTAAAATAACACTGATGG + Intronic
1043649395 8:82570599-82570621 CTGAAAAAAATGCCTACTGATGG + Intergenic
1044276538 8:90306839-90306861 TTGACATAAACTATCACTGATGG + Intergenic
1044801848 8:95965044-95965066 TTGAATTAAATGATCTCTAAGGG + Intergenic
1045014979 8:97993362-97993384 TTGAAATAAATGACCACTGATGG - Intronic
1046012811 8:108571060-108571082 TACAAATAAAAGACCAATGAAGG - Intergenic
1047250954 8:123181976-123181998 TTGAAATCTATGAACTCTGAGGG - Intronic
1047516501 8:125559162-125559184 TGGAAAGCAATGACCACTGAGGG - Intergenic
1048546927 8:135396091-135396113 TTGACATCAAAGACCCCTGATGG + Intergenic
1048910162 8:139127445-139127467 TTGAACTAAATTACCACATAGGG + Intergenic
1050282015 9:4060357-4060379 TTGAAAGGGATGACCACTGAAGG - Intronic
1051960137 9:22749946-22749968 TGAAAATAAATGACAACTGGGGG + Intergenic
1052205059 9:25828871-25828893 TTGACTTAAGTGTCCACTGATGG - Intergenic
1053286714 9:36854555-36854577 TTGAAATAAGTGACCTCCAAGGG + Intronic
1055917560 9:81421313-81421335 TTCAAATAAATGACAATTTAGGG + Intergenic
1056308190 9:85312183-85312205 CTGGGATAAAAGACCACTGAAGG - Intergenic
1056452006 9:86725485-86725507 ATGAAATAAATGAACAGGGAAGG - Intergenic
1057579934 9:96278769-96278791 TAGAAATAAATGAGGACTGTAGG + Intronic
1058713873 9:107705585-107705607 TTAAAACAAATGAGAACTGATGG + Intergenic
1058794464 9:108484387-108484409 GTGAAATAGATGACAATTGAGGG + Intergenic
1058862828 9:109133604-109133626 TTGACATAAATTACCAGTGCTGG - Exonic
1060132091 9:121112570-121112592 TTAAAATAACTCACCTCTGATGG - Exonic
1061419076 9:130463585-130463607 TGGAACTAGGTGACCACTGAGGG - Intronic
1061960854 9:133988347-133988369 TTTAAATAAATGATGACTGCAGG - Intronic
1186019421 X:5237403-5237425 TTTAAAGAGATGACCACAGAGGG - Intergenic
1186802958 X:13111820-13111842 ATGAATTAATTGACCCCTGAAGG - Intergenic
1187541313 X:20198521-20198543 TTGTAATTTATGTCCACTGAGGG + Intronic
1188646332 X:32572197-32572219 TTAAATTAAAAGACCAATGAGGG + Intronic
1190601372 X:52096420-52096442 TAGAAAAAAAAGTCCACTGATGG + Intergenic
1191826426 X:65370503-65370525 TTGAATAAAATGAACACTAAAGG + Intronic
1192387553 X:70687562-70687584 TTGTAACAAATTACCACAGATGG - Intronic
1194239811 X:91431540-91431562 ATGACATAAATGTCCATTGATGG - Intergenic
1196017128 X:110951798-110951820 GTGAAATGAATGACCATTTAGGG + Intronic
1199165947 X:144675395-144675417 TGGAAACAAATGAACCCTGAGGG - Intergenic
1200051728 X:153435705-153435727 TTGAAATAAGTGATGACAGAGGG + Intergenic