ID: 1045015166

View in Genome Browser
Species Human (GRCh38)
Location 8:97995059-97995081
Sequence CTGTACCCCTTGAATATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045015166_1045015171 1 Left 1045015166 8:97995059-97995081 CCAGCAATATTCAAGGGGTACAG 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1045015171 8:97995083-97995105 GTGTCAGCGGGTTGATATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045015166 Original CRISPR CTGTACCCCTTGAATATTGC TGG (reversed) Intronic
902036375 1:13461134-13461156 CTGGAACCCTTGAACATTGCTGG + Intergenic
903612390 1:24625206-24625228 CTGTAACTCTTATATATTGCTGG - Intergenic
905546739 1:38806032-38806054 CTGGAGCCCTTGTACATTGCTGG + Intergenic
905644827 1:39617747-39617769 CGGTGCCCCATGAATATTACTGG + Intergenic
905672978 1:39804682-39804704 CTGAACCCATAGAATTTTGCAGG + Intergenic
906550996 1:46666404-46666426 CTCTACCCCTTCACTATGGCAGG - Intronic
909801333 1:79812269-79812291 CTGGAGCTCTTGTATATTGCTGG + Intergenic
911924442 1:103810831-103810853 CTGTTGCCCTTGTATTTTGCAGG - Intergenic
912548691 1:110470029-110470051 CTGGAAACCTTGTATATTGCTGG - Intergenic
913319716 1:117579669-117579691 CAGTGCCCCTTGCAGATTGCTGG + Intergenic
914950155 1:152106841-152106863 TTATAACCCTTGAATAGTGCAGG - Exonic
919884368 1:201922118-201922140 TTGGACCCCTTGTATGTTGCTGG + Intronic
1064459807 10:15523210-15523232 CTTTGCCCCTTGGTTATTGCAGG + Intronic
1064999944 10:21329279-21329301 TTGGAACCCTTGCATATTGCTGG - Intergenic
1066086441 10:31976497-31976519 CTGGACACCTTGAACATGGCTGG + Intergenic
1066646797 10:37618576-37618598 CTGTACCCCTAGAGTCTGGCTGG + Intergenic
1068961753 10:62873380-62873402 CTGGAACCCTTGTACATTGCTGG - Intronic
1071264091 10:83948680-83948702 CTGCACCCCTTAAATGTTGAGGG - Intergenic
1071409343 10:85373638-85373660 CTGGAATCCTTGAATATTGTAGG + Intergenic
1072065046 10:91859938-91859960 TTGTAGCCCTTGAGTATTGTAGG + Intronic
1073612075 10:104954344-104954366 CTTTAGCACTTAAATATTGCTGG + Intronic
1078163049 11:8858484-8858506 CTCTTCTCCTTGAATATTGCTGG - Intronic
1079047223 11:17116418-17116440 CTGGAACCCTTCTATATTGCTGG + Intronic
1079732058 11:23945618-23945640 CTGTACTATTTCAATATTGCTGG + Intergenic
1081349031 11:42026451-42026473 CTGTACCCCTTGTATCTAGAAGG - Intergenic
1082644725 11:55708355-55708377 TTGGACTCCTTGAATATTACTGG - Intergenic
1082942836 11:58726399-58726421 CTGTCCCCCTTGAACCTGGCTGG - Intronic
1084552450 11:69853954-69853976 CTGGAACCCTTGTATGTTGCTGG + Intergenic
1088642677 11:111888440-111888462 CTGAAACCCTTGTGTATTGCTGG - Intergenic
1089669291 11:120041900-120041922 TTGTAGCCCTTGTACATTGCTGG + Intergenic
1095853933 12:46840303-46840325 CTTTACACATTAAATATTGCAGG - Intergenic
1098469641 12:70828396-70828418 ATGTAATCTTTGAATATTGCAGG - Intronic
1099647517 12:85378267-85378289 CTGTACCTCTTGCATATTTTAGG + Intergenic
1107376085 13:39806197-39806219 TTGGAACCCTTGTATATTGCTGG + Intergenic
1111251952 13:85613165-85613187 CTGTTCCCATTGAAGATGGCAGG + Intergenic
1112064656 13:95780405-95780427 CTGTATCCCTTGCATATTGCAGG - Intronic
1115823292 14:37235871-37235893 CTGGAACCCTTGTGTATTGCTGG - Intronic
1118195401 14:63621121-63621143 CTGGAACCCTTCTATATTGCTGG + Intronic
1120495858 14:85234338-85234360 CTTTACCTCTTAAATATTTCTGG + Intergenic
1121084304 14:91133755-91133777 CTGGAACCCTTGTACATTGCTGG - Intronic
1122013830 14:98776459-98776481 CTGGATTCCTTGAATAATGCAGG - Intergenic
1122447108 14:101777730-101777752 TTGGAACCCTTGTATATTGCTGG - Intronic
1202839423 14_GL000009v2_random:107717-107739 CTGTAACCCTTGAACACTGTTGG + Intergenic
1202918754 14_KI270723v1_random:11757-11779 CTGTGCCCCATAAATATTACTGG + Intergenic
1202925882 14_KI270724v1_random:23297-23319 CTGTGCCCCATAAATATTACTGG - Intergenic
1127558403 15:60110730-60110752 CTGTATTCCTTGAACAATGCCGG + Intergenic
1129310483 15:74704803-74704825 TTGGAACCCTTGAATATTGCTGG + Intergenic
1138235024 16:55374835-55374857 TTGAACCCCTTAAATATTGAAGG + Intergenic
1138319952 16:56103286-56103308 CTGAACCCCTTGCATCTTCCTGG - Intergenic
1144584349 17:16479031-16479053 CTGGACCCCTGCAATACTGCAGG + Intronic
1145319898 17:21759375-21759397 CTTTACCCCTTTAATAATGTGGG - Intergenic
1146139386 17:30351794-30351816 TTGTAACCCTTGTACATTGCTGG - Intergenic
1151677752 17:75607904-75607926 CTGGAACCCTTGTACATTGCTGG - Intergenic
1153192617 18:2558991-2559013 CTGGAGCCCTTGGGTATTGCTGG + Intronic
1154275804 18:12958962-12958984 CTGGAACCCTTGAGCATTGCTGG - Intronic
1155124962 18:22864921-22864943 GTGTGCCCCTTGAATAAGGCAGG - Intronic
1157225136 18:45855927-45855949 CTGGAACCCTTGCACATTGCTGG + Intronic
1159291352 18:66425890-66425912 CTGCCCCCCTGGAATCTTGCAGG - Intergenic
1161874994 19:6901477-6901499 CTCTACCCCTTAAATACAGCTGG - Intronic
1163394059 19:17048772-17048794 CTGGAGCCCTTTAATATTGAGGG - Intergenic
1163673160 19:18640904-18640926 CTGGAACTCTTGAACATTGCTGG - Intronic
1164728014 19:30479787-30479809 CTGTACCCTTTGGGTATGGCTGG + Intronic
929998414 2:46844603-46844625 CTGGATCCCTTGCACATTGCTGG - Intronic
931251470 2:60534496-60534518 CTGTTCCCCACGAACATTGCAGG - Intronic
931491791 2:62755584-62755606 CTGAAACTCTTCAATATTGCTGG - Intronic
933720743 2:85395885-85395907 CTGGGCCCCTGGAATATTTCAGG + Intronic
933784139 2:85824997-85825019 CTGGAACCCTTGTACATTGCTGG - Intergenic
936431115 2:112464437-112464459 CTGTACCACTTGTGCATTGCTGG + Intergenic
936719107 2:115228241-115228263 CTGTACCCCATGTATAGGGCCGG - Intronic
938833657 2:135077671-135077693 CTGGAGCCCTTGAGCATTGCTGG - Intronic
939636602 2:144590153-144590175 CTGCACCCCTTGCATATATCCGG - Intergenic
940040017 2:149350478-149350500 CTGTGTCCCTTGAATCCTGCAGG + Intronic
941546072 2:166853670-166853692 ATGGAACCCTCGAATATTGCTGG + Intergenic
942443356 2:176059219-176059241 CTGAAACCCTTGCACATTGCTGG + Intergenic
942452804 2:176118584-176118606 CTGAACCCTTAGAATGTTGCTGG + Intronic
943810465 2:192181540-192181562 CTGTACCCATTGAATAGAGGAGG - Intronic
944427958 2:199603480-199603502 CTTCACCCCTTGAATCTTGAGGG + Intergenic
947928805 2:233945095-233945117 CTGTTCTCCTTGAATTTTGGTGG + Intronic
1171782726 20:29436056-29436078 CTGTACCCCATAAATATTACTGG + Intergenic
1172638403 20:36425453-36425475 CTGGAACCCCTGTATATTGCTGG + Intronic
1176881188 21:14195966-14195988 CTGAAACCCTTGAACATTGCTGG + Intronic
1177846747 21:26298094-26298116 CTGTAACTCTTGTATATTGCTGG - Intergenic
1179503740 21:41825866-41825888 CTGTACTTATAGAATATTGCAGG - Intronic
1183861411 22:40673077-40673099 CTGAACCCCCTGAACATTCCAGG + Intergenic
951499730 3:23371640-23371662 CTGTAACTTTTGAAAATTGCTGG - Intronic
951717963 3:25668913-25668935 CTGTACCCTGTAATTATTGCAGG - Intergenic
952743944 3:36760754-36760776 CAGTACTTTTTGAATATTGCTGG - Intergenic
956999336 3:74867228-74867250 TTGTAGCCCTTGAAGATTACTGG + Intergenic
957240550 3:77655749-77655771 TTGTGCTCCTTGAATATGGCTGG - Intergenic
957985382 3:87568450-87568472 CTGTAACTCTTGTACATTGCTGG + Intergenic
958814967 3:98904444-98904466 CCCTACCCCTTTAATATAGCAGG + Intergenic
959370933 3:105524487-105524509 CTGAACACCTTGACTATTGTAGG - Exonic
959476261 3:106815694-106815716 CTGTATCCTTTAAAGATTGCTGG + Intergenic
962534903 3:136319029-136319051 CTGGAACCCTTGCACATTGCTGG - Intronic
965457640 3:168923768-168923790 CTGTACCAATTGAATGGTGCTGG + Intergenic
966564085 3:181356765-181356787 CTGAGCCCTTTGAATATAGCCGG - Intergenic
966803569 3:183787327-183787349 CTGGAACCCTTGTATATCGCTGG - Intronic
972580394 4:40390503-40390525 CTGTATCCCTAGAATTTTGATGG - Intergenic
981211690 4:142114397-142114419 CTGGAACCCTTGTACATTGCTGG - Intronic
986663853 5:10082848-10082870 CTGTACCCCTTGGGTGTTGTGGG - Intergenic
994974000 5:106779291-106779313 CTGTATCACTTGGCTATTGCAGG - Intergenic
995182429 5:109241337-109241359 CAGTACCTCTTGACTTTTGCAGG + Intergenic
996925313 5:128819296-128819318 CTGAAACCCTTATATATTGCTGG + Intronic
999112779 5:149136646-149136668 CTGTTTCCCTTGAATAAAGCTGG - Intergenic
999313331 5:150567981-150568003 TTGGAACCCTTGTATATTGCTGG - Intergenic
1000988278 5:167884870-167884892 CTGGAGCCCTTGTGTATTGCTGG - Intronic
1004735092 6:18397958-18397980 CTGTACCCGTTGAACATGCCAGG + Intronic
1005410324 6:25538750-25538772 CTGTGCCCCTAGAAAGTTGCAGG + Intronic
1016191597 6:141274709-141274731 ATGTACATCTTGCATATTGCAGG - Intergenic
1016782813 6:147978522-147978544 ATGTACCACTTGAATACTGCAGG - Intergenic
1016872754 6:148835356-148835378 TGGTACCCCTTGAATACTGATGG + Intronic
1017737358 6:157377623-157377645 TTGTACCCCTAGAATTTTCCAGG + Intergenic
1022616535 7:31936689-31936711 CTCTACCCCTTTAAAATTCCTGG - Intronic
1023645274 7:42306136-42306158 CTGTGTCACATGAATATTGCAGG + Intergenic
1027689520 7:81325518-81325540 TTGGAACCCTTGTATATTGCTGG - Intergenic
1029430744 7:100528085-100528107 TTGTAACCCTTGTACATTGCTGG - Intergenic
1029879458 7:103792091-103792113 CTGTAATCCTCAAATATTGCTGG + Intronic
1029904223 7:104074039-104074061 CTGTACTCCTAGACTCTTGCTGG - Intergenic
1032627124 7:133603699-133603721 CTTTACCCTTTGAATAGAGCTGG + Intronic
1034312994 7:150106323-150106345 CACTACTCCTTGAATATTACAGG + Intergenic
1034793870 7:153994339-153994361 CACTACTCCTTGAATATTACAGG - Intronic
1038469399 8:27800493-27800515 CTGAAACCCTTGTACATTGCTGG + Intronic
1042693493 8:71529740-71529762 CTGTTCCCCTTGCACAGTGCTGG - Intronic
1043238053 8:77893884-77893906 CTGTCGCCCTTGAATCTTTCAGG - Intergenic
1043549801 8:81357791-81357813 CTTTATCTCTTGAATATTACTGG + Intergenic
1045015166 8:97995059-97995081 CTGTACCCCTTGAATATTGCTGG - Intronic
1048653854 8:136513312-136513334 TTGTATCCCTGGAATATAGCAGG - Intergenic
1050349666 9:4728618-4728640 CTGTAACCCTCATATATTGCTGG + Intronic
1051127857 9:13824352-13824374 CTGTACCTTTTGAAGATTGTTGG - Intergenic
1051942119 9:22520480-22520502 CTGTACACTTTGAATATGCCAGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1058325444 9:103690695-103690717 CAGTCCCCCTTGGATATTGAGGG + Intergenic
1203442768 Un_GL000219v1:26935-26957 CTGTACCCCATAAATATTAATGG + Intergenic
1203513576 Un_KI270741v1:145844-145866 CTGTACCCCATAAATATTAATGG + Intergenic
1185774107 X:2788288-2788310 CTGTACCCATTCTATATTCCTGG - Intronic
1186757373 X:12686619-12686641 CTCTACCCCTTGTTTTTTGCTGG - Intronic
1187924876 X:24240577-24240599 TTGGAACCCTTGTATATTGCTGG + Intergenic
1191953654 X:66621274-66621296 CTGGAACCCTTGTGTATTGCTGG + Intronic
1192345944 X:70305810-70305832 CTGGAACCCTTATATATTGCTGG - Intronic
1196043905 X:111235804-111235826 CTTTACCCATTGAATAGTGTTGG - Intergenic
1196338578 X:114568989-114569011 TTGTACCCCTTGAATATATATGG - Intergenic
1197785221 X:130191479-130191501 CTGTGCCACTTGAATCATGCTGG - Intergenic
1199867311 X:151863796-151863818 CTGTATCACTTGAAAACTGCTGG - Intergenic
1201164655 Y:11197838-11197860 CTGAAACCCTTGAATACTGTTGG + Intergenic
1201295657 Y:12461106-12461128 CTGTACCCATTTTATATTCCTGG + Intergenic