ID: 1045015933

View in Genome Browser
Species Human (GRCh38)
Location 8:98001941-98001963
Sequence GGTCATGGGGTAATGGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045015925_1045015933 -1 Left 1045015925 8:98001919-98001941 CCAGCCATGACTCATGCTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 167
Right 1045015933 8:98001941-98001963 GGTCATGGGGTAATGGTTATTGG No data
1045015928_1045015933 -5 Left 1045015928 8:98001923-98001945 CCATGACTCATGCTTGGGGGTCA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1045015933 8:98001941-98001963 GGTCATGGGGTAATGGTTATTGG No data
1045015922_1045015933 14 Left 1045015922 8:98001904-98001926 CCACGCTGGCTTAGACCAGCCAT 0: 1
1: 0
2: 0
3: 10
4: 58
Right 1045015933 8:98001941-98001963 GGTCATGGGGTAATGGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045015933 Original CRISPR GGTCATGGGGTAATGGTTAT TGG Intronic
No off target data available for this crispr